ID: 940400496

View in Genome Browser
Species Human (GRCh38)
Location 2:153243143-153243165
Sequence CTGAGAGATGAGACACCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940400488_940400496 9 Left 940400488 2:153243111-153243133 CCTGGGTGATATGCACACATCCC No data
Right 940400496 2:153243143-153243165 CTGAGAGATGAGACACCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940400496 Original CRISPR CTGAGAGATGAGACACCAAT GGG Intergenic
No off target data available for this crispr