ID: 940400498

View in Genome Browser
Species Human (GRCh38)
Location 2:153243150-153243172
Sequence ATGAGACACCAATGGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940400492_940400498 -9 Left 940400492 2:153243136-153243158 CCCTCCACTGAGAGATGAGACAC No data
Right 940400498 2:153243150-153243172 ATGAGACACCAATGGGTGATGGG No data
940400491_940400498 -6 Left 940400491 2:153243133-153243155 CCACCCTCCACTGAGAGATGAGA No data
Right 940400498 2:153243150-153243172 ATGAGACACCAATGGGTGATGGG No data
940400488_940400498 16 Left 940400488 2:153243111-153243133 CCTGGGTGATATGCACACATCCC No data
Right 940400498 2:153243150-153243172 ATGAGACACCAATGGGTGATGGG No data
940400493_940400498 -10 Left 940400493 2:153243137-153243159 CCTCCACTGAGAGATGAGACACC No data
Right 940400498 2:153243150-153243172 ATGAGACACCAATGGGTGATGGG No data
940400489_940400498 -4 Left 940400489 2:153243131-153243153 CCCCACCCTCCACTGAGAGATGA No data
Right 940400498 2:153243150-153243172 ATGAGACACCAATGGGTGATGGG No data
940400490_940400498 -5 Left 940400490 2:153243132-153243154 CCCACCCTCCACTGAGAGATGAG No data
Right 940400498 2:153243150-153243172 ATGAGACACCAATGGGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940400498 Original CRISPR ATGAGACACCAATGGGTGAT GGG Intergenic
No off target data available for this crispr