ID: 940400633

View in Genome Browser
Species Human (GRCh38)
Location 2:153244499-153244521
Sequence GAGTGTGAGCAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940400623_940400633 24 Left 940400623 2:153244452-153244474 CCAAGTTTATCTCACTGGTACTG No data
Right 940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940400633 Original CRISPR GAGTGTGAGCAGAAGCAGGG TGG Intergenic
No off target data available for this crispr