ID: 940403859

View in Genome Browser
Species Human (GRCh38)
Location 2:153278227-153278249
Sequence TTAAGTTTCTTAAAGTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940403854_940403859 14 Left 940403854 2:153278190-153278212 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG No data
940403855_940403859 13 Left 940403855 2:153278191-153278213 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG No data
940403852_940403859 17 Left 940403852 2:153278187-153278209 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG No data
940403850_940403859 23 Left 940403850 2:153278181-153278203 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG No data
940403848_940403859 26 Left 940403848 2:153278178-153278200 CCGCCTCGGCCTCCCAAAGTGCT 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
Right 940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940403859 Original CRISPR TTAAGTTTCTTAAAGTTTCA GGG Intergenic
No off target data available for this crispr