ID: 940405757

View in Genome Browser
Species Human (GRCh38)
Location 2:153300027-153300049
Sequence CAGCTGTTCTAGAGCTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940405753_940405757 28 Left 940405753 2:153299976-153299998 CCGGTAGGTCTCAAATTGAGGCA No data
Right 940405757 2:153300027-153300049 CAGCTGTTCTAGAGCTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940405757 Original CRISPR CAGCTGTTCTAGAGCTCAGA AGG Intergenic
No off target data available for this crispr