ID: 940411650

View in Genome Browser
Species Human (GRCh38)
Location 2:153371045-153371067
Sequence TTTAATAATCCCAATTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940411650_940411653 10 Left 940411650 2:153371045-153371067 CCAACACAATTGGGATTATTAAA 0: 1
1: 0
2: 3
3: 23
4: 267
Right 940411653 2:153371078-153371100 GCTGGTTGATTCTAAATATACGG No data
940411650_940411651 -8 Left 940411650 2:153371045-153371067 CCAACACAATTGGGATTATTAAA 0: 1
1: 0
2: 3
3: 23
4: 267
Right 940411651 2:153371060-153371082 TTATTAAAACTGAGTCCAGCTGG 0: 1
1: 0
2: 1
3: 46
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940411650 Original CRISPR TTTAATAATCCCAATTGTGT TGG (reversed) Intergenic
901093620 1:6660649-6660671 TTTAATATTAGCAATTTTGTGGG - Intronic
901374958 1:8831356-8831378 TTAGATGATCCCAATTTTGTCGG - Intergenic
905833850 1:41099111-41099133 TTAGATAATCCCAGTTTTGTTGG - Intronic
905935649 1:41822024-41822046 TTTATTGCTCCCAATTCTGTGGG + Intronic
907478451 1:54724619-54724641 TTTAACAATTCTAAATGTGTAGG + Intronic
908035807 1:60051549-60051571 TTTATTTATCTCAATTGGGTTGG - Intronic
908879944 1:68720078-68720100 TTTAATAATCGCCATTCTGATGG - Intergenic
910022108 1:82604154-82604176 TTTAATGATACCTATTGTGCAGG + Intergenic
910805160 1:91182450-91182472 TCTAATAGCCCCAATTGAGTAGG - Intergenic
911632317 1:100197032-100197054 TTAGATGATCCCAATTTTGTTGG - Intronic
912098425 1:106174522-106174544 TTTAATAATCACCATTCTGAGGG - Intergenic
915866693 1:159508364-159508386 GTTATTCATCACAATTGTGTTGG + Intergenic
916368718 1:164063901-164063923 TGGAATAATCCCAATTTTGCTGG + Intergenic
916960787 1:169886408-169886430 TTTAAGAATGCACATTGTGTGGG - Intronic
918156889 1:181856351-181856373 TTTAAGAAACCAAATTCTGTTGG - Intergenic
918633223 1:186744325-186744347 TTTTATAATCCCATTTCTATGGG + Intergenic
918753231 1:188300325-188300347 TCTAATAGTGCCAATTTTGTGGG + Intergenic
919093930 1:193007080-193007102 GTTACTAATACCTATTGTGTAGG + Intergenic
919552683 1:199011501-199011523 TTTAATCCTCCCAATTCTTTAGG - Intergenic
919690137 1:200521726-200521748 TTTAAAAATGATAATTGTGTGGG + Intergenic
921561516 1:216664339-216664361 TTTAATCATCCCAATGAAGTAGG - Intronic
921890593 1:220349710-220349732 TTCAATAATCCCTACTGTGGAGG - Intergenic
922815908 1:228449161-228449183 TTAGATGATCCCAATTTTGTTGG + Intergenic
923588399 1:235296315-235296337 TTAGATGATCCCAATTTTGTTGG - Intronic
924837188 1:247662348-247662370 TTTAATAATGCAATTTTTGTAGG + Intergenic
1063316473 10:5011072-5011094 ATTATTTTTCCCAATTGTGTAGG - Intronic
1063357830 10:5417471-5417493 TTTAATAATTTCAATTGTATAGG + Intronic
1069166983 10:65172953-65172975 TTTAATTATCTTAATTGTGATGG - Intergenic
1069298954 10:66882943-66882965 TTTAAAAACCCCAGATGTGTGGG + Intronic
1069345473 10:67464449-67464471 TTTACTCATCCAACTTGTGTTGG + Intronic
1070187652 10:74081425-74081447 TTTAAGAACCCCAGTTGTGCAGG + Intronic
1070420805 10:76235285-76235307 TTTCATTATCCTAATTGTTTTGG - Intronic
1070437864 10:76411414-76411436 TATAATCATCCTAATTATGTTGG - Intronic
1070561723 10:77572846-77572868 TTTTAGAATTCCAATTGTTTCGG + Intronic
1071098789 10:82011362-82011384 TGTAATAATCCCATTTGTCAAGG - Intronic
1071111704 10:82165422-82165444 TATAATAATGTCAATTTTGTAGG + Intronic
1073314905 10:102572757-102572779 TTAAATGATCCCAATTTTGTTGG + Intronic
1073353230 10:102834465-102834487 TTTTATTATCCCCATTGTGCAGG - Intronic
1074112179 10:110430556-110430578 TTTAAGAATCACAATAGTCTAGG - Intergenic
1074270476 10:111948741-111948763 GTTCATAATCTCAATTGTGATGG + Intergenic
1075750237 10:124762936-124762958 TATAATAACTCCAATTCTGTAGG - Intronic
1079798130 11:24833322-24833344 TTTAGCAATCCCAGTTGTTTTGG - Intronic
1080563707 11:33488588-33488610 TATCATAATCCCAATTTTGTGGG + Intergenic
1081506146 11:43719124-43719146 TTAGATGATCCCAATTTTGTTGG - Intronic
1087819989 11:102701013-102701035 TTTAAAAATTGCAATTTTGTTGG + Intronic
1090133954 11:124176099-124176121 TATCATAATCTCAATTTTGTAGG + Intergenic
1091716662 12:2782349-2782371 TTAGATGATCCCAATTTTGTTGG - Intergenic
1092276416 12:7064546-7064568 TTTAATAATTTCAATAGTTTTGG + Intronic
1092819403 12:12339235-12339257 ATAAATAATCCCAGTTTTGTAGG - Intronic
1093254770 12:16853699-16853721 ATTGAGAATTCCAATTGTGTGGG + Intergenic
1093796098 12:23313804-23313826 TTTAATAAAGCAAATTGAGTTGG - Intergenic
1094346106 12:29470895-29470917 TTTAATAATCACCATTCTGATGG + Intronic
1094474260 12:30829144-30829166 TTTCACAATCCCTAGTGTGTCGG + Intergenic
1098467004 12:70798816-70798838 TCTAATAACCCCATTTGTGTGGG + Intronic
1098979255 12:76937273-76937295 TTTATTATTCCAAATTGTATTGG - Intergenic
1099536004 12:83845661-83845683 TATAACAATCCCAATTTTATTGG + Intergenic
1099586971 12:84531530-84531552 TTAATTAATCACTATTGTGTTGG - Intergenic
1100224140 12:92539399-92539421 ATTAAAAATACCCATTGTGTGGG - Intergenic
1100499556 12:95160737-95160759 TTTAAAAAACCCACCTGTGTGGG + Intronic
1102306431 12:111808173-111808195 TTTAAAAATACAAATTGAGTGGG - Intronic
1105519926 13:21122773-21122795 TTGAATAGTCCCCACTGTGTTGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105838872 13:24235844-24235866 TTTTAAAATCCCAAATGAGTTGG - Intronic
1106257971 13:28038916-28038938 TTTAATGATTCCACTTGTATGGG - Intronic
1108755739 13:53499905-53499927 TGTAATAATTCAAATTCTGTAGG + Intergenic
1109721343 13:66280259-66280281 TTTTAAAATCTCAATTTTGTAGG - Intergenic
1110247699 13:73345157-73345179 TTTAAAATTCCCAACTGTATGGG + Intergenic
1110472916 13:75880721-75880743 TATAATTATCCCAAATATGTGGG - Intronic
1110720471 13:78755394-78755416 TTTAATAATTCCATTTATGGTGG + Intergenic
1110796258 13:79641873-79641895 AATAATAATACCTATTGTGTGGG + Intergenic
1111288810 13:86133323-86133345 TTTAATAATGCCAAATGTTGTGG + Intergenic
1111693222 13:91591594-91591616 TTTTATAATCCCATGTGTCTTGG + Intronic
1111996852 13:95173819-95173841 TCTACTAATACCATTTGTGTTGG - Intronic
1112070890 13:95849154-95849176 TTTAATAATATCATTTGTGTAGG - Intronic
1114787066 14:25612816-25612838 TTTAATAATAGCCATTCTGTGGG + Intergenic
1114942251 14:27627683-27627705 TTTTACAATCAGAATTGTGTAGG + Intergenic
1115004939 14:28470373-28470395 TTAAATAAACTAAATTGTGTCGG - Intergenic
1115128793 14:30027789-30027811 TTTAATAATCACCATTCTGATGG + Intronic
1115181277 14:30628755-30628777 TTTAAAAATTCCAATTCTTTAGG + Intronic
1117225618 14:53655547-53655569 TTTACTAATCCCCTTTCTGTGGG + Intergenic
1117278058 14:54209381-54209403 ATTAATAATCTAAATTGTGTAGG - Intergenic
1117890534 14:60416978-60417000 TTTATTTATTCCAACTGTGTAGG - Intronic
1118090627 14:62472977-62472999 TTTAAGACTCCTAATTGTCTTGG + Intergenic
1120222573 14:81751139-81751161 TTTAATAACCACAATAGTATGGG + Intergenic
1121373456 14:93382507-93382529 TTTATTAAGCCCTATTTTGTAGG - Intronic
1121762349 14:96456576-96456598 TTAGATGATCCCAATTTTGTTGG + Intronic
1122009914 14:98737505-98737527 TTTATTAAACCGAATTGTGTTGG - Intergenic
1124568619 15:30839064-30839086 TTTATTTTTCCCATTTGTGTGGG + Intergenic
1125203765 15:37127633-37127655 TTTAACCATCCCCCTTGTGTTGG + Intergenic
1125279414 15:38027697-38027719 TTTAATAATCCCCATGGTCAAGG + Intergenic
1126601316 15:50430673-50430695 TTTGATAATCCCTATTGTTTTGG - Intronic
1127060264 15:55175247-55175269 TTTAATTCTCCCAATTATGAAGG - Intergenic
1130934084 15:88454315-88454337 TTTAATAATCCTAAATGTCAAGG + Intergenic
1131361578 15:91796500-91796522 TATAATAATCATAATTTTGTGGG - Intergenic
1131839357 15:96418812-96418834 ATAAATAATCCCAATGGTCTGGG + Intergenic
1132280020 15:100604420-100604442 TTTAATATCCCAAATTGTTTAGG + Intronic
1132520767 16:387211-387233 TTAGATGATCCCAATTTTGTTGG - Intergenic
1134129614 16:11640382-11640404 TTTCATAATCCCAATTGCGTAGG - Intergenic
1134413078 16:14019608-14019630 TTGAATATTCCCAAGTATGTGGG - Intergenic
1139785814 16:69390984-69391006 GTTAATAATCCCCATTGTCAGGG + Intronic
1140977966 16:80078980-80079002 ATTAATAAACCTAATTCTGTAGG + Intergenic
1144259030 17:13499720-13499742 TTAAATAATCTCAATAGAGTAGG + Intronic
1144263100 17:13542382-13542404 TTTAAGAACACCAATTCTGTTGG - Intronic
1146447610 17:32944856-32944878 TTTTATTATCCCAATTTTGCAGG + Intronic
1146551971 17:33788367-33788389 TTTAATAATCACCATTCTGTCGG - Intronic
1146958469 17:36951522-36951544 TTTAATCCTCCCAATTGCGCAGG + Intronic
1148629850 17:49098823-49098845 TTTAATAATTAAAATTGTCTGGG - Intergenic
1148903098 17:50893469-50893491 TTTCATCTTCCCCATTGTGTAGG + Intergenic
1149810723 17:59668295-59668317 TTTAATAATCCCAGTGCTTTGGG + Intronic
1149957651 17:61070319-61070341 TTAGATGATCCCAATTTTGTTGG - Intronic
1150179401 17:63100613-63100635 TATAAAAATCCCAAATCTGTTGG + Intronic
1153003232 18:475106-475128 TTTACAAATCCTAATTGAGTTGG - Intronic
1154301537 18:13197518-13197540 TATAGTAATCCAAATAGTGTGGG - Intergenic
1154389166 18:13921810-13921832 TTTTATGATCCAAATTGTGCTGG - Intergenic
1155104813 18:22652933-22652955 TTTAATATTCCTTATTGTGCCGG + Intergenic
1155223765 18:23709820-23709842 TTAGATGATCCCAATTTTGTTGG + Intronic
1155311311 18:24526661-24526683 TGGAATAATCCCAATGGTATGGG + Intergenic
1155536204 18:26820555-26820577 TTACATAATTCAAATTGTGTAGG - Intergenic
1156027211 18:32669009-32669031 ATTAATACAACCAATTGTGTTGG + Intergenic
1156716170 18:40013612-40013634 TTTCATACTCCTAATTGTATTGG - Intergenic
1157065024 18:44339636-44339658 TTTAAAAATCTCAATAGTTTGGG + Intergenic
1157110442 18:44815708-44815730 TTTGACAATCCCAATTGTGTTGG - Intronic
1158502256 18:58013221-58013243 TTTTTCAGTCCCAATTGTGTAGG + Intergenic
1158753343 18:60292091-60292113 TTTGATATTCTCAATAGTGTTGG - Intergenic
1159409503 18:68053560-68053582 TATAATAACCCCAAGTATGTGGG + Intergenic
1159504917 18:69324054-69324076 TTTGTTAATGCCAATTGAGTAGG + Intergenic
1159657135 18:71045014-71045036 TTTAATAATCCCAAGGATGTAGG + Intergenic
1162162452 19:8728735-8728757 TTAGATGATCCCAATTTTGTTGG + Intergenic
1163182159 19:15612101-15612123 TTAGATAATCCCAATTTTGTTGG - Intergenic
1164530481 19:29044485-29044507 TTTAATAAAACCAAATGTCTTGG - Intergenic
1167165191 19:47794466-47794488 TTAGATGATCCCAATTTTGTTGG + Intergenic
1167452273 19:49578417-49578439 TTTAAAAATCCCCATTGGGCAGG - Intronic
1168215742 19:54924296-54924318 TATAAGGATCCCCATTGTGTGGG - Intronic
926005996 2:9373834-9373856 TTTTACAATCCCAATTCTGAAGG - Intronic
926981095 2:18569655-18569677 TATAATAATCCTAAATATGTAGG + Intronic
930499764 2:52199204-52199226 TTTTATAATGCCATTTATGTGGG - Intergenic
930708707 2:54529784-54529806 TTGGATGATCCCAATTTTGTTGG - Intronic
931292792 2:60890623-60890645 TTTTATTATCCAAATTGTGGGGG - Intronic
931636706 2:64347266-64347288 TTAGATGATCCCAATTTTGTTGG + Intergenic
933766959 2:85716259-85716281 TGTAATAATATCATTTGTGTTGG + Intergenic
933974225 2:87495269-87495291 GTTGATAATCCCAAATGTCTAGG + Intergenic
934601027 2:95658791-95658813 TTGTATACTCCCAAATGTGTAGG + Intergenic
935496885 2:103793121-103793143 TTTAATAATCACCATTCTGATGG - Intergenic
936319601 2:111455555-111455577 GTTGATAATCCCAAATGTCTAGG - Intergenic
937233013 2:120411381-120411403 TTTAATAATCACCATTCTGATGG + Intergenic
937807182 2:126160469-126160491 TTTAAAAATCAGAATTGTGGTGG + Intergenic
940411650 2:153371045-153371067 TTTAATAATCCCAATTGTGTTGG - Intergenic
940596327 2:155797015-155797037 TTTAATAATGCCAGTTGTCAAGG - Intergenic
940715550 2:157219404-157219426 TTTAATAATGTCAATTTTTTTGG + Intergenic
941111340 2:161421608-161421630 TTCAGTAATCCCAAGTGGGTGGG + Intronic
941427132 2:165361919-165361941 TTTAAGATTCTGAATTGTGTGGG - Intronic
942634915 2:177992835-177992857 TTTGACAATCTCAATTATGTTGG - Intronic
943472558 2:188312823-188312845 TTTAATAATCGCCATTTTATTGG + Intronic
943492927 2:188579650-188579672 TTTAATAATGTCAACTGTTTTGG - Intronic
944161170 2:196661900-196661922 TTTAATCACCCCCATTATGTAGG - Intronic
944907594 2:204278077-204278099 TCTAATAATCCCATATGTTTTGG - Intergenic
945495498 2:210502921-210502943 TTTAAAAATCCCAATTTCTTTGG + Intronic
946303594 2:218842043-218842065 TTAGATGATCCCAATTTTGTTGG - Intergenic
947372174 2:229458322-229458344 TTTAACAATCCCAAATATGTAGG + Intronic
1168993362 20:2113660-2113682 TTCAATAATCCCAGTGCTGTAGG - Intronic
1169881181 20:10349157-10349179 TTAGATGATCCCAATTTTGTTGG + Intergenic
1170162499 20:13328271-13328293 TTTAATAATCACCATTCTGACGG - Intergenic
1170403832 20:16015377-16015399 TTTAATAACGACAATTGGGTGGG - Intronic
1170491501 20:16880323-16880345 TTGGATAATCCCAAAAGTGTAGG - Intergenic
1172590963 20:36117591-36117613 TATAATTATCCCCATTTTGTGGG + Intronic
1173877070 20:46379895-46379917 ATTAAAAATCTGAATTGTGTAGG - Intronic
1173935746 20:46862109-46862131 TATAACAATCCCAAATGAGTAGG - Intergenic
1174143724 20:48435607-48435629 TTTAATGATCACAAGTGGGTTGG + Intergenic
1176694145 21:9953392-9953414 TTTAATAATACCTATTATGCTGG + Intergenic
1178825829 21:36016079-36016101 TTAGATGATCCCAATTTTGTTGG + Intergenic
1179191741 21:39128018-39128040 TTAGATGATCCCAATTTTGTTGG - Intergenic
1179390718 21:40988113-40988135 TTTATTAATCCCACCTGTTTTGG - Intergenic
1182579342 22:31295169-31295191 TTTAAAAATCCCTATTATATTGG - Intergenic
949196757 3:1319096-1319118 TTTAAGTGGCCCAATTGTGTGGG - Intronic
950841836 3:15975304-15975326 TTTTATAGTCCCATTTGTTTGGG + Intergenic
951134737 3:19092143-19092165 TTAAATAATCTCAATTTTGATGG + Intergenic
951306599 3:21070622-21070644 TGTAATAATCCCACTTGTCAAGG - Intergenic
952378451 3:32786094-32786116 TTAGATGATCCCAATTTTGTTGG - Intergenic
956879508 3:73496409-73496431 ATTAATCATTCAAATTGTGTTGG - Intronic
956992321 3:74781315-74781337 TTTAATAATGGCCATTGTGGTGG - Intergenic
957671606 3:83312162-83312184 AATAATAATCCCAAATATGTAGG - Intergenic
957710571 3:83852929-83852951 TTTAATTAACCCAAGTGTGCAGG - Intergenic
958525122 3:95247537-95247559 TTAAACAAACACAATTGTGTAGG - Intergenic
962103789 3:132369958-132369980 ATTAATAATCACAATTGGGGTGG - Intergenic
962453182 3:135539025-135539047 GTTAATAATCCCCAATGTTTTGG + Intergenic
963024269 3:140902629-140902651 TTAGATGATCCCAATTTTGTTGG - Intergenic
963281247 3:143386489-143386511 TCTAATTATCCCCATTGTATTGG - Intronic
964881554 3:161429127-161429149 TTAGATGATCCCAATTTTGTTGG + Intergenic
965878914 3:173364539-173364561 TTTAATTATCACATCTGTGTTGG + Intergenic
967346232 3:188459047-188459069 TTTAAGAATGCCAGTTGTTTGGG - Intronic
967913749 3:194562978-194563000 TTAGATGATCCCAATTTTGTTGG + Intergenic
971084614 4:23258025-23258047 TTTAATAATCGCCATTCTGATGG - Intergenic
972446250 4:39146840-39146862 TTTAATGATTCCTATTCTGTAGG - Intergenic
973309547 4:48693890-48693912 TTAAATAATCCAAATTCTCTTGG + Intronic
973865999 4:55113666-55113688 TTTAAAAATCCTAATTCAGTTGG - Intronic
975708847 4:77138694-77138716 TTAGATGATCCCAATTCTGTTGG + Intergenic
975839491 4:78458418-78458440 TTTAATAAGAGAAATTGTGTGGG - Intronic
975863651 4:78703711-78703733 TTTCATAATCCTAATATTGTGGG + Intergenic
978567289 4:110096898-110096920 GTTATTAATACCAATTTTGTTGG - Intronic
978967623 4:114760942-114760964 TTTAATAATCCCAGTTCTCCTGG - Intergenic
979737855 4:124110218-124110240 TTTAATAATCCCTATGGCTTTGG + Intergenic
980366769 4:131813590-131813612 TTTAATAATGCCTATTATGCTGG + Intergenic
981157620 4:141458447-141458469 CTTAATAATCTCAAATATGTTGG - Intergenic
981488553 4:145314636-145314658 GTTAAAAATCCCAATTTTCTTGG + Intergenic
983644238 4:169973586-169973608 TTTAATAATCCCAAACGTACTGG + Intergenic
983724305 4:170901324-170901346 TATTATCATCCCAATTTTGTGGG + Intergenic
985046651 4:185947574-185947596 TTTTGTAATCCCTATTGTGTAGG - Intronic
986056376 5:4141358-4141380 TTTAATAATCGCCATTCTGATGG - Intergenic
990061303 5:51652370-51652392 GTTAATAATTCCAAATGTATAGG + Intergenic
990763999 5:59162113-59162135 TTTAATAAACTGAATTGTTTTGG - Intronic
991537852 5:67692769-67692791 TTCGATGATCCCAATTTTGTTGG + Intergenic
992840678 5:80688899-80688921 TTTAATAAGCTCAATTCTGTGGG + Intronic
994813981 5:104559784-104559806 TAAAATAAACCCCATTGTGTTGG - Intergenic
994894275 5:105682131-105682153 TTTAATAACCAAAACTGTGTGGG + Intergenic
996538474 5:124603953-124603975 TTTAAAAATACCAATTGTGTTGG + Intergenic
998570928 5:143256933-143256955 TTTTATAATCCCCATTTTATGGG - Intergenic
998657989 5:144204252-144204274 TTTAAAAATAGCAATTGTTTGGG + Intronic
998668297 5:144324390-144324412 TTTAATAATCTCCATTCTGATGG - Intronic
1000146035 5:158454369-158454391 TTTGATAATCCCCAGTGTGTAGG + Intergenic
1000308398 5:160017504-160017526 TGAAATAATCCCCATTGTGTTGG - Intronic
1000442138 5:161276575-161276597 TTGAATAACCCCCATTGTGATGG - Intergenic
1000452432 5:161406500-161406522 TATAATAATCCCAGTTTTGGTGG - Intronic
1001930807 5:175671662-175671684 TTTAATACTTGCAATTTTGTGGG - Intronic
1003046578 6:2738960-2738982 ATTAACAATCCCAATAGAGTGGG - Intronic
1003941784 6:11035544-11035566 TTTATTAATCCCAGTGATGTTGG + Intronic
1009532567 6:64839657-64839679 TTTATTTATCCCAATTATGGAGG + Intronic
1010913896 6:81591789-81591811 TTTTAAAATCAGAATTGTGTGGG + Intronic
1011393145 6:86876602-86876624 TTAAATAAACTAAATTGTGTTGG + Intergenic
1012531076 6:100237102-100237124 TTTAATAATCCCTCTTCTATGGG - Intergenic
1013028309 6:106303123-106303145 TTTAAAATTTCCAATTTTGTTGG - Intronic
1013204231 6:107932232-107932254 TTAGATCATCTCAATTGTGTTGG - Intronic
1014260343 6:119209132-119209154 GTTAATGATCCAAATTGTATCGG - Intronic
1014459549 6:121679972-121679994 TTAAATTATCCCAATTTTGTTGG + Intergenic
1015420098 6:132997570-132997592 TTAGATGATCCCAATTTTGTTGG + Intergenic
1015466029 6:133549620-133549642 TTTATTAATCCCCATTTTGTTGG - Intergenic
1017552711 6:155526380-155526402 TATAATAAACCCAATGGTGGAGG + Intergenic
1017683725 6:156890493-156890515 TTAAATTATCCCAGATGTGTTGG + Intronic
1017735323 6:157357607-157357629 TTACATAATCCCAATTAGGTAGG - Intergenic
1018496578 6:164353402-164353424 TTTAATAATAGCCATTCTGTCGG + Intergenic
1018738183 6:166705715-166705737 TTTAATAGTCTCTATTCTGTTGG - Intronic
1020663159 7:11006399-11006421 TTAGATGATCCCAATTTTGTTGG + Intronic
1021095872 7:16535482-16535504 TTTTATAATCCCAAATCTATTGG + Intronic
1022159065 7:27690758-27690780 TTTGATAATGCCAATTATATGGG - Intergenic
1022254117 7:28638684-28638706 TATAATAATATCAATTGTATTGG - Intronic
1023095022 7:36651400-36651422 TTTAACTATCCCAAGTCTGTAGG - Intronic
1023463864 7:40431785-40431807 TTTAAAAATCCCATTTATGACGG - Intronic
1024192605 7:47028011-47028033 TTTAAAAAGCCCAATTATATTGG - Intergenic
1027863915 7:83622294-83622316 TTTAATAATCACCATTCTGACGG - Intronic
1028068353 7:86416693-86416715 TTTAATTATCACTATTTTGTTGG + Intergenic
1028317052 7:89416043-89416065 TATAATAGTCCCAAATGTGTAGG - Intergenic
1029059013 7:97777757-97777779 TTTAATATTACCAATGGTTTAGG - Intergenic
1030858898 7:114598334-114598356 TTTAATAATAGCTTTTGTGTAGG - Intronic
1031831138 7:126627266-126627288 TTTGATAATCCCAACTGGGAAGG + Intronic
1034152348 7:148926815-148926837 TTTAAAAATCCCCAGTCTGTGGG + Intergenic
1034840775 7:154393532-154393554 TTGAACAATCTCCATTGTGTGGG - Intronic
1036074246 8:5476947-5476969 TTAGATAATCCCAATTTTGCCGG - Intergenic
1036273319 8:7327745-7327767 TTTAATAATCGCCATTCTGACGG - Intergenic
1036348030 8:7982607-7982629 TTTAATAATCGCCATTCTGACGG + Intergenic
1036843325 8:12143083-12143105 TTTAATAATCGCCATTCTGACGG + Intergenic
1036864689 8:12385398-12385420 TTTAATAATCACCATTCTGACGG + Intergenic
1037975402 8:23207347-23207369 TTAGATGATCCCAATTTTGTTGG - Intronic
1040989330 8:53332694-53332716 TATAATAAGCCCACATGTGTTGG - Intergenic
1041774875 8:61512699-61512721 TTTAATAATCCTAATTATACAGG + Intronic
1042865976 8:73357021-73357043 TTTAATAATCCACATTGTTTGGG + Intergenic
1046884248 8:119345808-119345830 TTTAAATATCCCAAGTATGTGGG + Intergenic
1046886583 8:119374261-119374283 TTTAAAAATCTGAAATGTGTAGG - Intergenic
1047470388 8:125166003-125166025 TTTCATAATCTTTATTGTGTTGG + Intronic
1049691256 8:143960668-143960690 TTTAAAAATCAAAATCGTGTTGG + Intronic
1050537030 9:6639589-6639611 TTAGATGATCCCAATTTTGTTGG - Intronic
1050619434 9:7437183-7437205 TCTCATAATCCCAATCTTGTAGG + Intergenic
1050669082 9:7975903-7975925 ATTAATAATCCCTAATTTGTAGG - Intergenic
1050699204 9:8318423-8318445 TTTAAAAATTCAAATTCTGTTGG - Intronic
1050749169 9:8917067-8917089 TTTTACAATCCCCATTGTATAGG + Intronic
1051020534 9:12537016-12537038 TTTAAAATTCCCAAATGTGTAGG - Intergenic
1051827589 9:21237269-21237291 TTTAATAATCACCATTCTGAGGG + Intronic
1052431949 9:28377718-28377740 TTTAATAATGCCATTTTTCTAGG + Intronic
1056184572 9:84121001-84121023 TTTGATAATCCCCATTCTGCAGG - Intergenic
1058344579 9:103945913-103945935 TTTAATGAACTCAATTTTGTTGG - Intergenic
1186366960 X:8905689-8905711 TTTAGAAATCTCAATTCTGTTGG + Intergenic
1188493248 X:30757464-30757486 GTTAATACTTGCAATTGTGTTGG - Intergenic
1191056100 X:56242937-56242959 TTAGATGATCCCAATTTTGTTGG + Intronic
1192726725 X:73761622-73761644 TTTAATAATCGCCATTCTGATGG + Intergenic
1193300211 X:79880603-79880625 TTTAATAATCCCAAAGGTCAAGG + Intergenic
1193324345 X:80162032-80162054 TTTAATAATCACCATTCTGACGG + Intergenic
1194060487 X:89190660-89190682 TTTAATAATCCCCAATATTTTGG - Intergenic
1194145999 X:90263888-90263910 TTTAAGAATTCCAAAAGTGTTGG - Intergenic
1194315730 X:92375055-92375077 TTTAATAATCCCAAATATTTAGG - Intronic
1195490405 X:105462156-105462178 CTTAATAATCCAAATTTTGATGG - Intronic
1197539775 X:127743669-127743691 TAAAATAATCCCTATTGTGGTGG - Intergenic
1199067797 X:143440873-143440895 TTTAATGATCACCATTGTCTTGG + Intergenic
1200368044 X:155688561-155688583 TTTAATAATAGCCATTGTGACGG + Intergenic
1200491741 Y:3833178-3833200 TTTAAGAATTCCAAAAGTGTTGG - Intergenic
1200623781 Y:5486589-5486611 TTTAATAATCCCAAATATTTAGG - Intronic
1200890261 Y:8315719-8315741 TTTCATAATCCCATTTGTAGGGG - Intergenic