ID: 940414923

View in Genome Browser
Species Human (GRCh38)
Location 2:153408527-153408549
Sequence CAAAAGGGACCCTGGCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940414918_940414923 15 Left 940414918 2:153408489-153408511 CCTATAACTTTCAATAAAGACTT No data
Right 940414923 2:153408527-153408549 CAAAAGGGACCCTGGCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940414923 Original CRISPR CAAAAGGGACCCTGGCTCAC TGG Intergenic
No off target data available for this crispr