ID: 940416819

View in Genome Browser
Species Human (GRCh38)
Location 2:153432622-153432644
Sequence TGGATGACAAGCAGCACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940416819_940416825 6 Left 940416819 2:153432622-153432644 CCCCCAGTGCTGCTTGTCATCCA No data
Right 940416825 2:153432651-153432673 CTAGTTGTCACCTTTTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940416819 Original CRISPR TGGATGACAAGCAGCACTGG GGG (reversed) Intergenic
No off target data available for this crispr