ID: 940420816

View in Genome Browser
Species Human (GRCh38)
Location 2:153477951-153477973
Sequence CTGCTACTTACTTGGAATGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940420816 Original CRISPR CTGCTACTTACTTGGAATGC GGG (reversed) Exonic
903564496 1:24254618-24254640 CCGCTCCTTACTTGGAAGTCTGG - Intergenic
907487136 1:54786069-54786091 CTTCTACTTCCTGGGAAAGCAGG - Exonic
907884244 1:58578190-58578212 CAGCTACTTACGTGGGATACAGG - Intergenic
910045811 1:82913953-82913975 TTGATTCTTACATGGAATGCAGG - Intergenic
917495771 1:175538798-175538820 CAGCTACTTTCTTGGCATACAGG + Intronic
918490207 1:185073666-185073688 CTGTTACTTACAAGGAATGCAGG + Intronic
920079389 1:203361300-203361322 CTTCCACTTACTTAAAATGCTGG - Intergenic
923759724 1:236830743-236830765 CTGCGACTAGCTTGGAAGGCTGG + Intronic
1065792318 10:29272241-29272263 ATGCTACATGTTTGGAATGCAGG - Intergenic
1068695736 10:59966407-59966429 CTGCTGTTTGCTTGGAATACAGG + Intergenic
1069107120 10:64396795-64396817 CTGCTACTTGTTTTGAATGGGGG + Intergenic
1073834840 10:107429391-107429413 CTGCTCCTTACTTGGGATTCAGG + Intergenic
1075219374 10:120571412-120571434 CAGACACTCACTTGGAATGCAGG + Intronic
1083574372 11:63779081-63779103 TTTCTTCTTCCTTGGAATGCTGG - Intergenic
1086592236 11:88529042-88529064 CTGCTACTTATTTGCAAAACGGG - Intronic
1090350131 11:126102728-126102750 CTGCTCCTTGCTAGGACTGCGGG - Intergenic
1091100445 11:132868096-132868118 CTGCTACTTCTGTGGAAAGCGGG + Intronic
1091475450 12:767883-767905 CTGCTACTCCCTTTGAATTCAGG + Intronic
1092245455 12:6861591-6861613 CAGCTACTGACTTGGCCTGCAGG - Exonic
1098606080 12:72391799-72391821 CTGCTACAGACATGGAATGTTGG - Intronic
1100837480 12:98580343-98580365 ATCCTAGCTACTTGGAATGCTGG + Intergenic
1102064802 12:109965451-109965473 CTGATACCTACTCTGAATGCAGG - Intronic
1102572671 12:113836598-113836620 CTGTAACTGACTTGGAAGGCAGG + Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1108286654 13:48915584-48915606 CTGCTCCCTACGTGGCATGCTGG + Intergenic
1109899704 13:68750772-68750794 TAGCTACATACTTGGAATACAGG - Intergenic
1110993399 13:82072476-82072498 CTGCCTCTTACTGTGAATGCTGG - Intergenic
1117391899 14:55270997-55271019 CTGCTGCTAGCTTGGAAGGCTGG - Intergenic
1118904055 14:70010665-70010687 TTGCTACTTACTTTGGATGCTGG + Intronic
1121987071 14:98517385-98517407 CTTCTATTGACTTGGTATGCAGG + Intergenic
1124098107 15:26668095-26668117 TTGCTACTTCCTTATAATGCAGG + Intronic
1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG + Intronic
1129977112 15:79831558-79831580 CTGCTCCTCATTTGGAGTGCAGG - Intergenic
1135931019 16:26736768-26736790 CTACTATTCACTTGGAATGTTGG - Intergenic
1135941871 16:26828800-26828822 CTCCTAGTTACTTGGGAGGCTGG + Intergenic
1139173388 16:64658569-64658591 CTGTTTCTTACTTGGACTGATGG - Intergenic
1140395167 16:74620199-74620221 CTGCTAGTTTCTTTGAATCCAGG - Intergenic
1141333192 16:83131136-83131158 CTGCTACTCACTTAGATAGCAGG + Intronic
1143049539 17:4112926-4112948 CAGCAACTAACTTGAAATGCTGG + Intronic
1143666538 17:8365314-8365336 CTCCTAGTTACTTGGCATACCGG - Intergenic
1148278988 17:46332474-46332496 CAGCTACTCACCTGGAATACTGG + Intronic
1148301203 17:46550336-46550358 CAGCTACTCACCTGGAATACTGG + Intronic
1148948905 17:51291413-51291435 CTGCTACTGACTTGGAATATCGG - Intronic
1149514145 17:57267294-57267316 CTGCTACTGACTTGGAACATAGG - Intronic
1150142420 17:62741468-62741490 ATGCTACTGACATGGATTGCTGG - Intronic
1153300937 18:3591555-3591577 GTGCCACCTACTTGGAAGGCTGG - Intronic
1153789923 18:8569195-8569217 TTGGTACTTATTTGGAATGATGG + Intergenic
1158253758 18:55521081-55521103 TTGCTACTTACTAGGAATTCTGG + Intronic
1159833396 18:73306096-73306118 CTGGTACTAACTTGGAATTCTGG + Intergenic
1167078355 19:47262787-47262809 TTACTAGCTACTTGGAATGCTGG + Intronic
1167838591 19:52095564-52095586 CTCCTACTTACTTGGGACGAAGG + Intronic
1168158150 19:54489907-54489929 CGGCAGCTTACCTGGAATGCTGG - Intergenic
926620684 2:15044250-15044272 CTGCTACTTACCTGCAAATCAGG - Intergenic
930231421 2:48847596-48847618 CTGATATATACTGGGAATGCAGG - Intergenic
930806407 2:55494986-55495008 CAGCTACTCACTTGGGAAGCTGG + Intergenic
931427821 2:62187097-62187119 CTACCACTTAATTGGAATGTTGG - Intergenic
935043036 2:99452912-99452934 TTGCTAGTTACTTGGATTTCAGG + Intronic
937385068 2:121422064-121422086 CTTCTGCTTACATGAAATGCTGG + Intronic
938433666 2:131268475-131268497 CTGCTACTTACCTGGAAATAAGG - Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940616583 2:156056111-156056133 CTCCTTCTTTCTTGGAATACAGG - Intergenic
948014450 2:234676646-234676668 CTGCTCCTCCCTGGGAATGCTGG + Intergenic
1170356070 20:15492911-15492933 CTTTTAGTTACTTGGAAGGCTGG + Intronic
1179188485 21:39103703-39103725 CTGCTACTGACTTGGATTTCAGG - Intergenic
1182167105 22:28186895-28186917 CTGCTACTTTCTTGGAAAGAAGG - Intronic
949245337 3:1920172-1920194 CTGCTACATATTTAGAATTCAGG + Intergenic
949471508 3:4401489-4401511 CTGCTGCTTGCTTGGAAAGTAGG - Intronic
951765819 3:26197504-26197526 CTGATACTTACTTGAAAAACTGG + Intergenic
952734533 3:36675673-36675695 CTTTTACTTACTTGAAAAGCTGG + Intergenic
955035621 3:55264409-55264431 ATGCTACTTACTAGGAGTGATGG + Intergenic
962548491 3:136463217-136463239 CAGCTACTTACTGGGCATGCTGG - Intronic
970664841 4:18324860-18324882 ATAATACTTACTTGGAATGCAGG - Intergenic
973980644 4:56305715-56305737 GTGCTCCTGACTTGGCATGCTGG + Intronic
975678621 4:76852635-76852657 CTGCTACTCACTGGGCATGGTGG + Intergenic
977866424 4:102033800-102033822 TTGCTACTTATTTGGGATACAGG - Intronic
981224768 4:142280824-142280846 CTGACATTTACTTGGAATGTTGG + Intronic
983331814 4:166339536-166339558 TTGTAACTTACTTGGAAAGCTGG + Intergenic
987720594 5:21627892-21627914 CTGTTACTCACTTGGAAAGGCGG - Intergenic
988963075 5:36388896-36388918 CTGCTATTTGCTTGGAAGGAGGG + Intergenic
996019771 5:118578262-118578284 CTGGCACTCACTTGGAATGTAGG + Intergenic
1004722222 6:18277511-18277533 CTGCTCCTTACTTGGACCTCGGG + Intergenic
1007996419 6:46312849-46312871 CTGCTCCCTACTTGGCATGTTGG + Intronic
1010496379 6:76537772-76537794 CTGCGACTTAGTTGTAAAGCAGG - Intergenic
1016925443 6:149341728-149341750 TTGCTAGTTACTGGAAATGCAGG + Intronic
1017909737 6:158782532-158782554 CTGCTCTTTACGTGGAAAGCAGG + Intronic
1020652138 7:10888799-10888821 CTCCCACTTACTTGGGATTCTGG - Intergenic
1023594402 7:41813738-41813760 CTGCAAATTTCTTGGAATCCAGG + Intergenic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1030455207 7:109763759-109763781 TTGATGCTTACTTGCAATGCTGG - Intergenic
1031583089 7:123501172-123501194 CTTCTTCTCACATGGAATGCAGG + Intronic
1034097255 7:148421301-148421323 CTGATCCTTATTTGGAATGAGGG + Intergenic
1036290804 8:7487969-7487991 TTGCTGGTTACCTGGAATGCTGG + Intronic
1036330685 8:7823568-7823590 TTGCTGGTTACCTGGAATGCTGG - Intronic
1038065627 8:23960873-23960895 CTGACACTTACATGGAATGAAGG - Intergenic
1040088762 8:43373088-43373110 CAGCTACTTACTTGGAAATATGG - Intergenic
1044720049 8:95136131-95136153 CTGCTATGTTCTTGGCATGCAGG - Intronic
1047851383 8:128861192-128861214 TTGGTAGTTACTTGGAATTCAGG - Intergenic
1051017089 9:12491569-12491591 TTGCTATTTACTTGGAAAGAAGG + Intergenic
1052161196 9:25262031-25262053 CTGCTACTTCCTTTGAGTGATGG - Intergenic
1054823567 9:69548149-69548171 CTGCTGCTGACTTGGAAGACGGG + Intronic
1057264579 9:93606089-93606111 CAGCTACTTACTTAGGAGGCTGG - Intronic
1057465491 9:95310552-95310574 CTGTCTCTTACTTGGGATGCTGG - Intronic
1061035717 9:128113362-128113384 ATGCTACTTACTTTCATTGCCGG + Intergenic
1061147112 9:128806481-128806503 CTGCCACTGACCTGGAATGTTGG + Intronic
1062535411 9:137019061-137019083 CTGCTACATACTTGGGGTGGAGG + Exonic
1185575702 X:1170486-1170508 CTGCTACATTCTTAGCATGCTGG - Intergenic
1190106838 X:47567065-47567087 CTGCTGGTGACTTGGAATGTGGG - Exonic
1196615632 X:117764045-117764067 CTGCTACTTTCTAGGAAGGTTGG - Intergenic
1197079951 X:122400337-122400359 CTGCTACTCATTTGGAGTACGGG + Intergenic
1198167209 X:134069741-134069763 CTGCAACTTACTTTGATTGATGG + Intergenic
1200377571 X:155799898-155799920 ATGATTCTTACTTGGGATGCTGG + Intergenic