ID: 940422828

View in Genome Browser
Species Human (GRCh38)
Location 2:153499453-153499475
Sequence CAGTGACGGCCTGAAGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940422828_940422838 2 Left 940422828 2:153499453-153499475 CCCCATGCTTCAGGCCGTCACTG No data
Right 940422838 2:153499478-153499500 TTGAAGGTGGGATTTCACTGGGG No data
940422828_940422834 -10 Left 940422828 2:153499453-153499475 CCCCATGCTTCAGGCCGTCACTG No data
Right 940422834 2:153499466-153499488 GCCGTCACTGGCTTGAAGGTGGG No data
940422828_940422837 1 Left 940422828 2:153499453-153499475 CCCCATGCTTCAGGCCGTCACTG No data
Right 940422837 2:153499477-153499499 CTTGAAGGTGGGATTTCACTGGG No data
940422828_940422836 0 Left 940422828 2:153499453-153499475 CCCCATGCTTCAGGCCGTCACTG No data
Right 940422836 2:153499476-153499498 GCTTGAAGGTGGGATTTCACTGG No data
940422828_940422839 23 Left 940422828 2:153499453-153499475 CCCCATGCTTCAGGCCGTCACTG No data
Right 940422839 2:153499499-153499521 GGACCTGCCCCTTTCCACCCAGG 0: 13
1: 50
2: 109
3: 203
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940422828 Original CRISPR CAGTGACGGCCTGAAGCATG GGG (reversed) Intergenic
No off target data available for this crispr