ID: 940424677

View in Genome Browser
Species Human (GRCh38)
Location 2:153516856-153516878
Sequence CTGTGTAAAGAGAAGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940424677_940424684 27 Left 940424677 2:153516856-153516878 CCTTCCCACTTCTCTTTACACAG No data
Right 940424684 2:153516906-153516928 CAAATAACTTACTCTCTTGTAGG No data
940424677_940424685 28 Left 940424677 2:153516856-153516878 CCTTCCCACTTCTCTTTACACAG No data
Right 940424685 2:153516907-153516929 AAATAACTTACTCTCTTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940424677 Original CRISPR CTGTGTAAAGAGAAGTGGGA AGG (reversed) Intergenic
No off target data available for this crispr