ID: 940425386

View in Genome Browser
Species Human (GRCh38)
Location 2:153525648-153525670
Sequence TTTCACATACTGGTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940425386_940425396 22 Left 940425386 2:153525648-153525670 CCCACCCCCACCAGTATGTGAAA No data
Right 940425396 2:153525693-153525715 TCCCTAGTGCCAAAAAGGCTGGG 0: 6
1: 174
2: 1278
3: 1740
4: 1351
940425386_940425395 21 Left 940425386 2:153525648-153525670 CCCACCCCCACCAGTATGTGAAA No data
Right 940425395 2:153525692-153525714 ATCCCTAGTGCCAAAAAGGCTGG No data
940425386_940425398 23 Left 940425386 2:153525648-153525670 CCCACCCCCACCAGTATGTGAAA No data
Right 940425398 2:153525694-153525716 CCCTAGTGCCAAAAAGGCTGGGG 0: 6
1: 169
2: 1263
3: 1651
4: 1373
940425386_940425394 17 Left 940425386 2:153525648-153525670 CCCACCCCCACCAGTATGTGAAA No data
Right 940425394 2:153525688-153525710 AAACATCCCTAGTGCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940425386 Original CRISPR TTTCACATACTGGTGGGGGT GGG (reversed) Intergenic
No off target data available for this crispr