ID: 940429132

View in Genome Browser
Species Human (GRCh38)
Location 2:153567430-153567452
Sequence CAGGCCTTTGTGTCCTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940429132_940429140 26 Left 940429132 2:153567430-153567452 CCAGGTAAGGACACAAAGGCCTG No data
Right 940429140 2:153567479-153567501 CCTGCTTTGCAGGCACAGCATGG No data
940429132_940429136 -4 Left 940429132 2:153567430-153567452 CCAGGTAAGGACACAAAGGCCTG No data
Right 940429136 2:153567449-153567471 CCTGGTGAGGAGTGAGTAACAGG No data
940429132_940429137 16 Left 940429132 2:153567430-153567452 CCAGGTAAGGACACAAAGGCCTG No data
Right 940429137 2:153567469-153567491 AGGTGAATACCCTGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940429132 Original CRISPR CAGGCCTTTGTGTCCTTACC TGG (reversed) Intergenic
No off target data available for this crispr