ID: 940429135

View in Genome Browser
Species Human (GRCh38)
Location 2:153567449-153567471
Sequence CCTGTTACTCACTCCTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940429135_940429137 -3 Left 940429135 2:153567449-153567471 CCTGGTGAGGAGTGAGTAACAGG No data
Right 940429137 2:153567469-153567491 AGGTGAATACCCTGCTTTGCAGG No data
940429135_940429141 27 Left 940429135 2:153567449-153567471 CCTGGTGAGGAGTGAGTAACAGG No data
Right 940429141 2:153567499-153567521 TGGTTTCAGAAAATCTTAAAAGG No data
940429135_940429140 7 Left 940429135 2:153567449-153567471 CCTGGTGAGGAGTGAGTAACAGG No data
Right 940429140 2:153567479-153567501 CCTGCTTTGCAGGCACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940429135 Original CRISPR CCTGTTACTCACTCCTCACC AGG (reversed) Intergenic
No off target data available for this crispr