ID: 940429136

View in Genome Browser
Species Human (GRCh38)
Location 2:153567449-153567471
Sequence CCTGGTGAGGAGTGAGTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940429132_940429136 -4 Left 940429132 2:153567430-153567452 CCAGGTAAGGACACAAAGGCCTG No data
Right 940429136 2:153567449-153567471 CCTGGTGAGGAGTGAGTAACAGG No data
940429128_940429136 16 Left 940429128 2:153567410-153567432 CCATTAGCATTGGTAGAAGTCCA No data
Right 940429136 2:153567449-153567471 CCTGGTGAGGAGTGAGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940429136 Original CRISPR CCTGGTGAGGAGTGAGTAAC AGG Intergenic
No off target data available for this crispr