ID: 940429137

View in Genome Browser
Species Human (GRCh38)
Location 2:153567469-153567491
Sequence AGGTGAATACCCTGCTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940429132_940429137 16 Left 940429132 2:153567430-153567452 CCAGGTAAGGACACAAAGGCCTG No data
Right 940429137 2:153567469-153567491 AGGTGAATACCCTGCTTTGCAGG No data
940429135_940429137 -3 Left 940429135 2:153567449-153567471 CCTGGTGAGGAGTGAGTAACAGG No data
Right 940429137 2:153567469-153567491 AGGTGAATACCCTGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940429137 Original CRISPR AGGTGAATACCCTGCTTTGC AGG Intergenic
No off target data available for this crispr