ID: 940432211

View in Genome Browser
Species Human (GRCh38)
Location 2:153606106-153606128
Sequence GCACCCATTAGGTTGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940432208_940432211 24 Left 940432208 2:153606059-153606081 CCTATAGCAGGCAATGACAGTGA No data
Right 940432211 2:153606106-153606128 GCACCCATTAGGTTGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940432211 Original CRISPR GCACCCATTAGGTTGAAAGC AGG Intergenic
No off target data available for this crispr