ID: 940441187

View in Genome Browser
Species Human (GRCh38)
Location 2:153718638-153718660
Sequence GGAGGCAGCAGGTGTCAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940441182_940441187 10 Left 940441182 2:153718605-153718627 CCATCTTCATATTCTTCTAACGC No data
Right 940441187 2:153718638-153718660 GGAGGCAGCAGGTGTCAGGACGG No data
940441181_940441187 30 Left 940441181 2:153718585-153718607 CCACAAGTCACGTTTCATAGCCA No data
Right 940441187 2:153718638-153718660 GGAGGCAGCAGGTGTCAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940441187 Original CRISPR GGAGGCAGCAGGTGTCAGGA CGG Intergenic
No off target data available for this crispr