ID: 940442062

View in Genome Browser
Species Human (GRCh38)
Location 2:153727886-153727908
Sequence GTGGGTAAGGGGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940442062_940442069 -9 Left 940442062 2:153727886-153727908 CCCTCCACTTTCCCCTTACCCAC No data
Right 940442069 2:153727900-153727922 CTTACCCACTGACAGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940442062 Original CRISPR GTGGGTAAGGGGAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr