ID: 940442698

View in Genome Browser
Species Human (GRCh38)
Location 2:153736973-153736995
Sequence CTGCCCTCCCAGAAGAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940442698_940442706 29 Left 940442698 2:153736973-153736995 CCATCACTCTTCTGGGAGGGCAG No data
Right 940442706 2:153737025-153737047 TTCTATGTTGTTCTATCATCGGG No data
940442698_940442699 -3 Left 940442698 2:153736973-153736995 CCATCACTCTTCTGGGAGGGCAG No data
Right 940442699 2:153736993-153737015 CAGTCCTCTGCAAGCCCACTTGG No data
940442698_940442700 -2 Left 940442698 2:153736973-153736995 CCATCACTCTTCTGGGAGGGCAG No data
Right 940442700 2:153736994-153737016 AGTCCTCTGCAAGCCCACTTGGG No data
940442698_940442705 28 Left 940442698 2:153736973-153736995 CCATCACTCTTCTGGGAGGGCAG No data
Right 940442705 2:153737024-153737046 ATTCTATGTTGTTCTATCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940442698 Original CRISPR CTGCCCTCCCAGAAGAGTGA TGG (reversed) Intergenic
No off target data available for this crispr