ID: 940443264

View in Genome Browser
Species Human (GRCh38)
Location 2:153744964-153744986
Sequence CCTGGTTTGCAGGCAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940443259_940443264 7 Left 940443259 2:153744934-153744956 CCTGGTGAGGAGTGAGTGACAAG No data
Right 940443264 2:153744964-153744986 CCTGGTTTGCAGGCAGAGCATGG No data
940443256_940443264 26 Left 940443256 2:153744915-153744937 CCAGGTAGGGACACGAAGGCCTG No data
Right 940443264 2:153744964-153744986 CCTGGTTTGCAGGCAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940443264 Original CRISPR CCTGGTTTGCAGGCAGAGCA TGG Intergenic
No off target data available for this crispr