ID: 940445901

View in Genome Browser
Species Human (GRCh38)
Location 2:153777405-153777427
Sequence TTTCAACATATGACTTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940445901_940445902 4 Left 940445901 2:153777405-153777427 CCTCAAAAAGTCATATGTTGAAA No data
Right 940445902 2:153777432-153777454 ATCACCAATGCGATAGTTTAAGG No data
940445901_940445908 19 Left 940445901 2:153777405-153777427 CCTCAAAAAGTCATATGTTGAAA No data
Right 940445908 2:153777447-153777469 GTTTAAGGAGGTGGGGCTGTTGG No data
940445901_940445907 12 Left 940445901 2:153777405-153777427 CCTCAAAAAGTCATATGTTGAAA No data
Right 940445907 2:153777440-153777462 TGCGATAGTTTAAGGAGGTGGGG No data
940445901_940445909 23 Left 940445901 2:153777405-153777427 CCTCAAAAAGTCATATGTTGAAA No data
Right 940445909 2:153777451-153777473 AAGGAGGTGGGGCTGTTGGTTGG No data
940445901_940445903 7 Left 940445901 2:153777405-153777427 CCTCAAAAAGTCATATGTTGAAA No data
Right 940445903 2:153777435-153777457 ACCAATGCGATAGTTTAAGGAGG No data
940445901_940445906 11 Left 940445901 2:153777405-153777427 CCTCAAAAAGTCATATGTTGAAA No data
Right 940445906 2:153777439-153777461 ATGCGATAGTTTAAGGAGGTGGG No data
940445901_940445905 10 Left 940445901 2:153777405-153777427 CCTCAAAAAGTCATATGTTGAAA No data
Right 940445905 2:153777438-153777460 AATGCGATAGTTTAAGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940445901 Original CRISPR TTTCAACATATGACTTTTTG AGG (reversed) Intergenic