ID: 940445907

View in Genome Browser
Species Human (GRCh38)
Location 2:153777440-153777462
Sequence TGCGATAGTTTAAGGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940445901_940445907 12 Left 940445901 2:153777405-153777427 CCTCAAAAAGTCATATGTTGAAA No data
Right 940445907 2:153777440-153777462 TGCGATAGTTTAAGGAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940445907 Original CRISPR TGCGATAGTTTAAGGAGGTG GGG Intergenic
No off target data available for this crispr