ID: 940445908

View in Genome Browser
Species Human (GRCh38)
Location 2:153777447-153777469
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940445901_940445908 19 Left 940445901 2:153777405-153777427 CCTCAAAAAGTCATATGTTGAAA No data
Right 940445908 2:153777447-153777469 GTTTAAGGAGGTGGGGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type