ID: 940446534

View in Genome Browser
Species Human (GRCh38)
Location 2:153784630-153784652
Sequence CCTCTTTTGCTGGGAAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940446534_940446542 27 Left 940446534 2:153784630-153784652 CCCGGGCTTCCCAGCAAAAGAGG No data
Right 940446542 2:153784680-153784702 AACTCACATACATACCCCTAGGG No data
940446534_940446541 26 Left 940446534 2:153784630-153784652 CCCGGGCTTCCCAGCAAAAGAGG No data
Right 940446541 2:153784679-153784701 AAACTCACATACATACCCCTAGG No data
940446534_940446540 1 Left 940446534 2:153784630-153784652 CCCGGGCTTCCCAGCAAAAGAGG No data
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940446534 Original CRISPR CCTCTTTTGCTGGGAAGCCC GGG (reversed) Intergenic
No off target data available for this crispr