ID: 940446536

View in Genome Browser
Species Human (GRCh38)
Location 2:153784631-153784653
Sequence GCCTCTTTTGCTGGGAAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 2, 1: 3, 2: 11, 3: 40, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940446536_940446540 0 Left 940446536 2:153784631-153784653 CCGGGCTTCCCAGCAAAAGAGGC 0: 2
1: 3
2: 11
3: 40
4: 226
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data
940446536_940446542 26 Left 940446536 2:153784631-153784653 CCGGGCTTCCCAGCAAAAGAGGC 0: 2
1: 3
2: 11
3: 40
4: 226
Right 940446542 2:153784680-153784702 AACTCACATACATACCCCTAGGG No data
940446536_940446541 25 Left 940446536 2:153784631-153784653 CCGGGCTTCCCAGCAAAAGAGGC 0: 2
1: 3
2: 11
3: 40
4: 226
Right 940446541 2:153784679-153784701 AAACTCACATACATACCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940446536 Original CRISPR GCCTCTTTTGCTGGGAAGCC CGG (reversed) Intergenic
903140940 1:21338914-21338936 CCCTCCTTGGCTGGGAAGGCAGG - Intronic
904255764 1:29253747-29253769 ACCTCTTTTGGTGGGAAGCTTGG + Intronic
905206778 1:36347105-36347127 GCCGCTTCTGCTGGAGAGCCAGG - Intronic
907408003 1:54265545-54265567 GGCTCTTCTGCTGGGTAGCCAGG - Intronic
907571241 1:55486126-55486148 GCCACTGAGGCTGGGAAGCCAGG - Intergenic
910812568 1:91253359-91253381 GCTGCTTTTGCTAGGAAGCCTGG - Intergenic
912413317 1:109492266-109492288 GCCTCTTCTGGTGGGAGCCCTGG + Intronic
912448992 1:109758226-109758248 CCCTCTTTTTCTAGGAGGCCAGG - Intronic
914900439 1:151708671-151708693 CCCTCATTTGCTGGGGCGCCAGG - Intronic
917149721 1:171930432-171930454 GCTGCTTTTGTTGGAAAGCCTGG + Intronic
917535309 1:175870388-175870410 GGCACTTTTCCTGGGAAGGCAGG - Intergenic
917586057 1:176426927-176426949 CCTGCTTTTGCTGAGAAGCCTGG + Intergenic
918266555 1:182847506-182847528 GTCTCCTTTGCTGGGCAGCTTGG + Intronic
919355380 1:196516022-196516044 GCTGCCTTTGCTGGGAAGTCTGG - Intronic
921013250 1:211162833-211162855 GCTACTTTTGCTGGGAGGCCAGG + Intergenic
921739895 1:218671643-218671665 GACGGTCTTGCTGGGAAGCCAGG + Intergenic
922385242 1:225075007-225075029 GTTACTTTTGCTGGAAAGCCTGG + Intronic
924451756 1:244184905-244184927 GCCTCTGGTTATGGGAAGCCAGG - Intergenic
1062972276 10:1657741-1657763 GCTTCCTTTGCTGGGAGGCATGG + Intronic
1068516006 10:58026497-58026519 ACTTCTTTTGTTTGGAAGCCAGG + Intergenic
1068775150 10:60861064-60861086 ACCTCTTATCTTGGGAAGCCTGG - Intergenic
1069893623 10:71667088-71667110 GCCTCTGTTGCTGGGACCCAGGG + Intronic
1071354057 10:84775745-84775767 ACTTTTTTTGCTGGGCAGCCTGG + Intergenic
1072427864 10:95345204-95345226 GCCTCTCTTGCAGGGAAGCTGGG - Intronic
1072633225 10:97161209-97161231 ACCTCTTGTGCTGGGAAGGAGGG - Intronic
1074557798 10:114507983-114508005 GCTGCTTTGGCTGGGAAGCTGGG - Intronic
1076422141 10:130339060-130339082 GGATCCTGTGCTGGGAAGCCTGG - Intergenic
1076539382 10:131204547-131204569 GCCACCGCTGCTGGGAAGCCAGG - Intronic
1076555667 10:131319804-131319826 GCCTCCTTTCCTAGAAAGCCTGG - Intergenic
1076732816 10:132446870-132446892 GCCTCAGGTGCTGGGAGGCCTGG + Intronic
1079921338 11:26437229-26437251 GCCACTTTTGCCAGGAAGCCTGG + Intronic
1080408872 11:32004638-32004660 CCATCCTTTGCTGGGATGCCTGG + Intronic
1080500985 11:32870746-32870768 GCCTCTGTGGCTGGGATTCCAGG - Intergenic
1081921186 11:46778957-46778979 GCCTCCTCAGCTGGGAAGCTGGG - Intronic
1085481348 11:76825265-76825287 GCCTCTTCTGCTGGGAGTGCAGG - Intergenic
1086569392 11:88264490-88264512 GCTACTTTTGCTGGAAAGCCTGG + Intergenic
1087046061 11:93844908-93844930 GGCTGCTTTGCTGGGAAGTCTGG - Intronic
1089268077 11:117281227-117281249 GCCTCTTGTGCTGGGATTACAGG + Intronic
1090199413 11:124843496-124843518 GGCTCTTTTGCTGTTTAGCCGGG - Intergenic
1090279256 11:125442177-125442199 GCTTCGTTTCCAGGGAAGCCAGG - Intergenic
1091058874 11:132443434-132443456 GTCTCTCTTGCTGGGCAGCAGGG - Intronic
1091363371 11:134996470-134996492 GCCTCTTAAGATTGGAAGCCAGG + Intergenic
1091467985 12:702252-702274 TACTGTTATGCTGGGAAGCCAGG + Intergenic
1091532608 12:1374226-1374248 GCTCCATTTGCTGGAAAGCCTGG - Intronic
1091641291 12:2239524-2239546 AGCTCTTTTCCTGGGAAGCCCGG + Intronic
1091714313 12:2766165-2766187 GCCAATCTTGCTGGGCAGCCAGG + Intergenic
1092588027 12:9920269-9920291 ACTACTTTTGCTGGGAAGCCTGG + Intronic
1093387944 12:18582502-18582524 GCCACTTTTGCTAGGAAGCCCGG - Intronic
1093528845 12:20136540-20136562 GCCACTTTTGCTGGGAAGCCTGG + Intergenic
1095356085 12:41277263-41277285 GCTTCATTTGATGGGAAGCAGGG - Intronic
1095698404 12:45165698-45165720 GTTGCTTTTTCTGGGAAGCCCGG + Intergenic
1096652709 12:53069745-53069767 GCCTCTCTCCCCGGGAAGCCAGG + Intronic
1097582903 12:61480733-61480755 GTTACTTTTGCTGGGAAGTCTGG - Intergenic
1097728589 12:63101999-63102021 TCCTCTCTTGCTGAGATGCCCGG + Intergenic
1098144726 12:67487054-67487076 GCTGCTTTTGCTGGGAAGTGTGG - Intergenic
1100134891 12:91543597-91543619 GCTACTTTTGCTAGGAAGCCTGG - Intergenic
1102834257 12:116039348-116039370 TTCTCTTTTGCTGGGAAACTGGG - Intronic
1103086625 12:118066359-118066381 GCCACTTCTGCTGTGAATCCTGG - Exonic
1103543855 12:121685730-121685752 GCCTCTTAACCTGGGAAGACCGG + Intergenic
1104650617 12:130529654-130529676 GACTCTTTTGCTGGGAGGTTGGG - Intronic
1106321737 13:28645792-28645814 GCCTCTTTTGTTTGAATGCCTGG - Intergenic
1108383027 13:49872285-49872307 GGCTTTTTTGGTGGGAAGCATGG + Intergenic
1110808663 13:79788827-79788849 GCTGCTTTTTCTGGGAAGCCTGG - Intergenic
1112031086 13:95457379-95457401 TCCTCTTTCGTTGAGAAGCCAGG + Intronic
1113578404 13:111411031-111411053 GCCTTTGTTGCTGGGAAGGCTGG + Intergenic
1114343311 14:21768498-21768520 GGCTTTTTGGCTGAGAAGCCTGG + Intergenic
1114988549 14:28261309-28261331 GCCACTTTTGCTGGGAAGCCCGG - Intergenic
1116027849 14:39536634-39536656 GCTGCTTTTGCTGGGAAGCCTGG - Intergenic
1116932385 14:50703000-50703022 ACTACTTTTGCTGGGAAGTCTGG + Intergenic
1117820508 14:59644528-59644550 GCTGCTTTTGCCAGGAAGCCCGG - Intronic
1122950640 14:105042589-105042611 GCTCCTGTCGCTGGGAAGCCGGG - Intergenic
1123174541 14:106403928-106403950 GCCTCTGGAGCTGGGAAGTCTGG - Intergenic
1123182764 14:106484873-106484895 GCCTCTGGAGCTGGGAAGTCTGG - Intergenic
1202944143 14_KI270726v1_random:11856-11878 GCCTCTGCTGCTGGGAAGTCTGG + Intergenic
1125673727 15:41491575-41491597 GCCCCTTTTTCTTGGCAGCCAGG + Intergenic
1126109671 15:45167934-45167956 GACTCTTTAGATGTGAAGCCAGG - Exonic
1127331047 15:57940371-57940393 GCTACTTTTGCTGGGAAGCCTGG + Intergenic
1127580022 15:60329714-60329736 GCCTCATTTGTTGAAAAGCCAGG - Intergenic
1128563483 15:68683663-68683685 GCCTCGAATGCTGGGAAGCAGGG + Intronic
1131834228 15:96374058-96374080 GTCTCATCTACTGGGAAGCCAGG - Intergenic
1132540559 16:506792-506814 CCCTCTTCTGCTGAGAATCCTGG - Intronic
1134849687 16:17470286-17470308 GCCTCTTGCCCCGGGAAGCCGGG - Intronic
1139469562 16:67170836-67170858 GGCTCTTTGGCCAGGAAGCCAGG - Intronic
1139703573 16:68725010-68725032 GCCTTCTTTGCTTGGAAGCGGGG + Intergenic
1140863613 16:79040680-79040702 GACTCTTTTGCAGGGTAGCTGGG - Intronic
1140930045 16:79618961-79618983 GTCTCCTCTGATGGGAAGCCAGG + Intergenic
1141502037 16:84450967-84450989 GCCACTTTTGTTGGGAAGTGGGG + Intronic
1142542880 17:674703-674725 ACCTGTTTTGCTGTGGAGCCTGG - Intronic
1143829528 17:9639894-9639916 GCTTCTTTGGCTGGGAAGGCAGG + Intronic
1144798593 17:17910185-17910207 GCCTCCTTTGACGGGAAACCCGG + Intronic
1147916382 17:43889696-43889718 AACTCTTTAACTGGGAAGCCAGG - Intronic
1149005896 17:51805060-51805082 GACTGTCTTGCTGGGACGCCTGG + Intronic
1151625733 17:75274397-75274419 GCAGCTTTTGGAGGGAAGCCAGG - Intronic
1151702788 17:75752325-75752347 GCCTCTTGGGCTGGGTGGCCAGG - Exonic
1152355271 17:79803786-79803808 GACTTTTTTGCTGGGACGTCGGG + Intergenic
1154488732 18:14902406-14902428 GCCTCTTAAGATTGGAAGCCGGG - Intergenic
1155091506 18:22515571-22515593 GTTACTTTTGCTGGGAAGCCGGG + Intergenic
1156488015 18:37478863-37478885 TCCTGTTTGGCTGGAAAGCCTGG + Intronic
1157568737 18:48698235-48698257 GCCTCTGCTGCTGGGCAGCTGGG + Intronic
1158660967 18:59387176-59387198 GACTGTTTTGCTGGGAAGCCAGG + Intergenic
1159622077 18:70650436-70650458 GCCTCATTATTTGGGAAGCCAGG - Intronic
1161542907 19:4862835-4862857 TCCCCTTTTGCTGGGCATCCAGG - Intronic
1162126552 19:8502520-8502542 GCCTCACTGGCTGGGAAGCAAGG - Intronic
1162254180 19:9474663-9474685 GCCTTTTTTTTTGGGAAGCAGGG + Intronic
1163241468 19:16066567-16066589 CCCTCTTGTGCTGGGAATCAAGG - Intergenic
1163420145 19:17209784-17209806 GGCTTTGTTGCTGGGAAGGCTGG + Intronic
1163577009 19:18116929-18116951 GTCTCTTTAGCTATGAAGCCTGG + Intronic
1163584849 19:18157935-18157957 CCCTGTAGTGCTGGGAAGCCAGG + Intronic
1164045137 19:21531339-21531361 GCCTCTTTTGTTGGGTCCCCAGG - Intronic
1164302257 19:23972499-23972521 CCCTCTCTGGCGGGGAAGCCTGG - Intergenic
1164825880 19:31284589-31284611 GCCTCCTCTGCTGGAAACCCTGG + Intronic
1165520982 19:36313621-36313643 GCCTCTTTAGCTGGGATTACAGG - Intergenic
1165623090 19:37264965-37264987 GCCTCTTTAGCTGGGATTACAGG + Intergenic
1166210536 19:41304066-41304088 GCGGCTGTTGCTGGGGAGCCCGG - Exonic
925107766 2:1307853-1307875 GCCGCTTCTGAGGGGAAGCCCGG - Intronic
927503851 2:23600557-23600579 GCCCCCTTTGCAGGAAAGCCCGG - Intronic
928441807 2:31298296-31298318 GCATCCTTTGCTTGGATGCCAGG - Intergenic
930033058 2:47069895-47069917 GCCTTTCCAGCTGGGAAGCCAGG - Intronic
930305219 2:49667563-49667585 GCCACTTTTGCTGGGAAGCCTGG + Intergenic
930982511 2:57544850-57544872 TCCTCTTTTGCTTGCAACCCTGG + Intergenic
932692765 2:73927155-73927177 GCCTCTTTTTCTGGGCTGCGAGG + Intronic
932813255 2:74841838-74841860 GCCTGTCTTGTTGGGAAGCCTGG - Intronic
932820763 2:74897829-74897851 GCCTCTTTTTCTGGGACCCCTGG + Intergenic
933141869 2:78801357-78801379 GCCTCTCTTGATGGGAACCTAGG - Intergenic
934684729 2:96312659-96312681 GCCTCATCTGCTGCAAAGCCAGG + Intergenic
935541905 2:104358475-104358497 GCCTCTTCAGCTGGATAGCCTGG - Intergenic
939584250 2:143987682-143987704 GCCCTTATTGCTGGGAAGCAAGG - Intronic
940446536 2:153784631-153784653 GCCTCTTTTGCTGGGAAGCCCGG - Intergenic
944128602 2:196321093-196321115 GCCTTCCCTGCTGGGAAGCCTGG + Intronic
945505590 2:210636669-210636691 GCCTCTTTTGCTTGGAACGATGG - Intronic
946415262 2:219537011-219537033 GCCTCTCTTCCTGAGAAGGCTGG - Intronic
947996155 2:234529542-234529564 TGCTCATTTGCAGGGAAGCCTGG + Intergenic
948434291 2:237942641-237942663 TCCTGCTTTGCTGGGGAGCCAGG + Intergenic
1170508673 20:17054982-17055004 GCTACTTTTGCTGGGAAGCCCGG + Intergenic
1172414632 20:34754826-34754848 GCCTGTCCTGCTGAGAAGCCAGG + Exonic
1172602168 20:36191268-36191290 GCCTTATCTGCTGGGAGGCCAGG + Intronic
1173164724 20:40679321-40679343 GGCACATTTGCTGGGATGCCTGG + Intergenic
1174158868 20:48536154-48536176 GCATCTCTTGCTGGGAAGGAAGG - Intergenic
1174330434 20:49813046-49813068 GCTTCTTTTGCTGGTTGGCCAGG + Intronic
1175214535 20:57384746-57384768 CCCTCTGGTGCTGGGGAGCCAGG + Intergenic
1175700440 20:61132987-61133009 GCCCAGTGTGCTGGGAAGCCAGG + Intergenic
1180844724 22:18974854-18974876 GCCTCTTCTGCGGGGCAGCAGGG + Intergenic
1180921480 22:19523698-19523720 GCCTCTTGTGCTGCGGCGCCTGG - Exonic
1181056747 22:20263858-20263880 GCCTCTTCTGCGGGGCAGCAGGG - Intronic
1181629855 22:24145030-24145052 GCATCTTCTGCTCAGAAGCCTGG - Intronic
1182289549 22:29267420-29267442 GCCTACCTTACTGGGAAGCCGGG + Exonic
1182303880 22:29354583-29354605 GCCTCTTCTGCTGGGAATGGGGG - Intronic
1182801833 22:33038122-33038144 GCAGCTTTTGGTGGGGAGCCTGG - Intronic
1183695649 22:39420477-39420499 GCCTCTGTTGATGGGAACTCTGG - Intronic
1183710192 22:39498809-39498831 TGCCCTTTTGCTGGGAAGCCTGG + Intergenic
1183733574 22:39631326-39631348 CCCTTTTTAGCTGGGGAGCCAGG + Intronic
950422660 3:12907870-12907892 GCCTCCTCTCCTGGGAAACCCGG - Intronic
950487206 3:13280934-13280956 GCCGCCTTGGCCGGGAAGCCGGG - Intergenic
950809135 3:15634420-15634442 GACGCTTTAGCTGGGAGGCCAGG + Intronic
951871781 3:27369588-27369610 GCCTCTTCTGCTTGCAAGCTTGG - Intergenic
952903989 3:38127781-38127803 CTCACTTCTGCTGGGAAGCCAGG + Exonic
953568943 3:44056639-44056661 CTCTTTCTTGCTGGGAAGCCGGG + Intergenic
954640117 3:52092880-52092902 GCCTCTTGGCCTGGGAAGGCTGG + Intronic
955057131 3:55464919-55464941 GCATCTATTCCAGGGAAGCCTGG - Intergenic
955681451 3:61505799-61505821 GTCACTTTTGCTGGGAAGCCTGG + Intergenic
956931413 3:74047737-74047759 GCCTCTTCTCCTTGGAAGCCAGG + Intergenic
959950625 3:112176034-112176056 GCTGCTTTTGCTGGGAGGCCTGG + Intronic
961724028 3:128914157-128914179 GAGACTTTTGCTGGGAAGGCTGG + Intronic
961755208 3:129122788-129122810 GCCCCATTTGATGGGAAGCTAGG + Intronic
963056881 3:141193427-141193449 GTTACTTTTGCTGGGAAGCCCGG - Intergenic
964251061 3:154718180-154718202 GCATCTTTTGCTGTTAAACCAGG + Intergenic
964480256 3:157132249-157132271 CCCTCTTTTCCTGAGAAGGCAGG + Intergenic
966151993 3:176875554-176875576 GCTGCTTTTGCTGAAAAGCCTGG + Intergenic
967097284 3:186187415-186187437 GGCTCTTGTGATGGGAAGGCTGG + Intronic
967984718 3:195086394-195086416 GCCTCTGTTCCAGGGAAGCAGGG - Intronic
968611713 4:1560158-1560180 TCCTCCTTTTCTAGGAAGCCTGG + Intergenic
968636498 4:1683840-1683862 GCCGCTTTTTCTGCGTAGCCTGG - Intronic
968739043 4:2318103-2318125 GCTTCTCTGCCTGGGAAGCCTGG + Intronic
968915451 4:3495289-3495311 GGCTCCTTTGCTGGGGAGCCAGG + Intronic
969343806 4:6558829-6558851 GCATCTTTAGATGGGAGGCCAGG - Intronic
970510000 4:16772317-16772339 GCCTGCTTTGCTCTGAAGCCTGG + Intronic
971230641 4:24798363-24798385 GTCTCTCCTGCTGGGAACCCTGG + Intronic
972990284 4:44815259-44815281 GTCACCTTTGCTGGGAATCCTGG + Intergenic
975106364 4:70572558-70572580 GCTTTTTTTGCTAGGAAGCCTGG + Intergenic
975519962 4:75290054-75290076 GCCTCTTGCTCTGAGAAGCCTGG + Intergenic
977394237 4:96451268-96451290 GCTACTTTTGCTGGGAAGCATGG + Intergenic
978238912 4:106492395-106492417 GCTACTTTTGCTGGGAAGCTCGG + Intergenic
978715565 4:111838666-111838688 GCCTCTCTTGCAGTTAAGCCTGG - Intergenic
979013156 4:115396516-115396538 GCTGCTTTTGCTGGGAAGCCCGG + Intergenic
980930306 4:139177536-139177558 GCGTCTTTACCTGGGAAGGCGGG - Intergenic
982499001 4:156130622-156130644 GCCACTTTTGCCAGGAACCCTGG - Intergenic
982645962 4:158026135-158026157 GCTGCTTTTGCTGGGAAGCCTGG - Intergenic
985411438 4:189689841-189689863 GACTCCTCTGCTGGGCAGCCTGG + Intergenic
985759309 5:1737038-1737060 GCCTCTTTATCTGGGAGGCAAGG - Intergenic
987370412 5:17187762-17187784 GACTCTGTAGCTGGGAAGCAAGG + Intronic
989734523 5:44688032-44688054 GGCTCTTTTGCAGAGAAGTCAGG + Intergenic
991130570 5:63118026-63118048 GTCTCCTTTCCTGGCAAGCCAGG + Intergenic
991135434 5:63176688-63176710 GCTGCTTTTGCCTGGAAGCCTGG + Intergenic
992069601 5:73136671-73136693 GTCTCTTTTCCTGGGAAGATAGG + Intergenic
994235370 5:97356335-97356357 GTCACTTTCACTGGGAAGCCTGG + Intergenic
994346896 5:98697694-98697716 GTCACTTTTGCCAGGAAGCCTGG + Intergenic
995184003 5:109252950-109252972 GCCTCTTTTTCTGGGGAGAGGGG + Intergenic
996901792 5:128551477-128551499 GTTACTTTTGCTGGGAAGCCTGG - Intronic
997873951 5:137531749-137531771 GACTCTTGTGCTGTGAAGACTGG + Intronic
998230582 5:140359161-140359183 GACTCGTTAGCTGGGCAGCCAGG + Intergenic
998696144 5:144642032-144642054 GCCTCCTGATCTGGGAAGCCTGG - Intergenic
999959202 5:156735815-156735837 GCTACTTGTGCTGGGAAGCCTGG + Intronic
1001676946 5:173526596-173526618 GCATCCATTGCTGGGAAGCAAGG - Intergenic
1002541386 5:179908401-179908423 GCCTCTTTAGCTGGGATTACAGG + Intergenic
1005799775 6:29409526-29409548 GTTACTTTTGCTGGGAAGCCTGG - Intronic
1008335688 6:50302042-50302064 TCATCTTTTGCTGTGCAGCCCGG - Intergenic
1009325609 6:62345205-62345227 GCTGCTTTTGCCAGGAAGCCTGG - Intergenic
1009890042 6:69669520-69669542 TACTCTTTTACTGGGAAGACTGG + Intergenic
1012616234 6:101283100-101283122 GCTGCTTTTGCTGAGAAGCCTGG - Intergenic
1014183147 6:118407266-118407288 GCTACTTTTGCTGGGAAGCCGGG - Intergenic
1014244526 6:119053438-119053460 GCCTGCTTTGCTGGGAAGATAGG - Intronic
1015003273 6:128246705-128246727 CTCTCTTCTTCTGGGAAGCCTGG - Intronic
1017994646 6:159521420-159521442 GCTGCTTTTGCCAGGAAGCCTGG + Intergenic
1018364070 6:163100222-163100244 GCCTCTCGTGCTGGGATCCCTGG + Intronic
1019061785 6:169262594-169262616 GCCTCTGTTCCTGGGGAGCGGGG - Intergenic
1021355540 7:19650399-19650421 GCCACTAATGCTGGGATGCCTGG - Intergenic
1021844604 7:24752343-24752365 GCCTCTCCTGCAGGGCAGCCAGG + Intronic
1022424442 7:30254742-30254764 GCCTCTTTTGCTGGGTCCCATGG + Intergenic
1024524793 7:50338764-50338786 CCCTCTCTTGCTGGCAAGGCAGG + Intronic
1025158722 7:56634754-56634776 GCTACTTTTTCTGGGAAGCCTGG - Intergenic
1025727889 7:64083500-64083522 GCTACTTTTTCTGGGAAGCCTGG + Intronic
1025756979 7:64353015-64353037 GCTACTTTTTCTGGGAAGCCTGG + Exonic
1026225355 7:68435556-68435578 GCCACTTTAGCTGGGAATACTGG - Intergenic
1028671996 7:93411626-93411648 GGCTCTGCTGCAGGGAAGCCAGG + Intergenic
1029253120 7:99250983-99251005 GGCTCATGTGCTGGGAACCCAGG - Intergenic
1030203031 7:106925069-106925091 GTTTCTTTGCCTGGGAAGCCTGG - Intergenic
1035049374 7:155989831-155989853 GCCTCTTGTGCTGGGGAGTTTGG + Intergenic
1035114633 7:156514414-156514436 GACACTTGTGCTGGGAACCCGGG + Intergenic
1035163716 7:156970527-156970549 GCCTCTTTAGCTGGGACTACAGG + Exonic
1039606436 8:38884564-38884586 GCCTCTGTTTCTGGGATGACAGG + Intergenic
1040372426 8:46789740-46789762 GCTACTTTTTCTGGGAAGCCTGG + Intergenic
1041390526 8:57343609-57343631 GCCTCTGAGGCTGGTAAGCCAGG - Intergenic
1041551034 8:59101949-59101971 GCTTCTGTTTCTGGGCAGCCAGG - Intronic
1043592310 8:81845686-81845708 GCATGTTATGCTGGGAAGCCAGG + Intergenic
1045580848 8:103478237-103478259 GCTTCTTTTTCTGAGAAGCTAGG - Intergenic
1045699616 8:104850726-104850748 GCCACTTCTGCCTGGAAGCCTGG + Intronic
1047026074 8:120826002-120826024 GCCTCTTTTGCAGGGTTGCAGGG - Intergenic
1048345732 8:133572763-133572785 CCCTCTTTTACAGGGAAGCGGGG + Intergenic
1051821917 9:21179706-21179728 GCTTCTTTTGTGGGGAAGCCTGG - Intergenic
1051823137 9:21191768-21191790 GCTTCTTTTGTGGGGAGGCCTGG - Intergenic
1051824965 9:21210305-21210327 GCTTCTTTTGTGGGGAGGCCTGG - Intronic
1051826955 9:21232368-21232390 GCTTCTTTTGTGGGGAAGCCTGG - Intronic
1053303224 9:36966312-36966334 GCCTCTGTCGCTGGCCAGCCAGG - Intronic
1053543335 9:38997346-38997368 GCTTCTTTTGATAGGCAGCCAGG - Intergenic
1053807767 9:41820853-41820875 GCTTCTTTTGATAGGCAGCCAGG - Intergenic
1054622825 9:67366575-67366597 GCTTCTTTTGATAGGCAGCCAGG + Intergenic
1055224807 9:73983751-73983773 GCTACTTTTTGTGGGAAGCCTGG - Intergenic
1055277308 9:74633374-74633396 GCCTATCTTGCAGAGAAGCCTGG - Intronic
1056186554 9:84140614-84140636 GCCGCTTTGCCTGGGGAGCCAGG - Intergenic
1057048961 9:91907615-91907637 GCCTCCTCTGCTGGGAAACCTGG + Intronic
1060242296 9:121914540-121914562 GTCTCTTTTACTGGGCAGCTTGG - Intronic
1060807621 9:126587661-126587683 GCCTCTTTTGCAGGCAAGTACGG + Intergenic
1061269088 9:129526392-129526414 GCATCTGTTGGTGGGAACCCTGG - Intergenic
1061697426 9:132387434-132387456 GCCTCTCTAGCAGGGAAGACTGG + Intronic
1061927600 9:133813589-133813611 GCCTCTCTAGAGGGGAAGCCGGG + Intronic
1203671158 Un_KI270755v1:13141-13163 GACTCCTCTGCTGGGCAGCCCGG - Intergenic
1186771082 X:12818794-12818816 GCCTCGCTTGCTGGTGAGCCTGG - Intronic
1187023820 X:15411741-15411763 GCCTCTTGTCCTAGGAGGCCAGG - Intronic
1187693924 X:21899260-21899282 GCCTCTTTTGCAGGTAGGGCTGG + Intergenic
1189073225 X:37887358-37887380 TACTCTTTTGCTGGCATGCCAGG + Intronic
1189674235 X:43444300-43444322 GCCACTTTTGCCAGGAAGCCAGG + Intergenic
1190977094 X:55416523-55416545 GTCACTTTTGCCAGGAAGCCCGG - Intergenic
1191120151 X:56894774-56894796 GCCTCTGCTGCTGGGAAACAGGG + Intergenic
1191123306 X:56927636-56927658 GCTGCTATTGCTGGGATGCCTGG + Intergenic
1192067843 X:67904703-67904725 GCCACTTTTGTTGGGAAGCCTGG + Intergenic
1192832828 X:74768007-74768029 GCCTCTTTTGCTGGGAAGCCCGG + Intronic
1192923862 X:75735346-75735368 GTTGCTTTTGCTGGGAAGCATGG + Intergenic
1194055709 X:89128488-89128510 GCTTCTTTTGTTGGGATGCCTGG + Intergenic
1194917298 X:99722111-99722133 GTTACTTTTGCTGGGAAGCCTGG - Intergenic
1195346185 X:103953333-103953355 GCTACTTTTGCTAGGATGCCCGG - Intronic
1196152941 X:112393910-112393932 GCTACTTTTGCTGGGAAGCCTGG + Intergenic
1196645823 X:118116736-118116758 GCTCCTATTCCTGGGAAGCCTGG - Intronic
1198262972 X:134982970-134982992 GCCTCTGCTGCTGGGAAGTTGGG + Intergenic
1200068555 X:153516910-153516932 GCCCCTGGAGCTGGGAAGCCTGG + Intergenic
1200076013 X:153551328-153551350 GCCTCTTTTGCTGTGCTGACTGG + Intronic
1200860491 Y:7986970-7986992 ACTACTTTTTCTGGGAAGCCTGG - Intergenic
1202250282 Y:22864246-22864268 GCTACTTTTTCTGGGAATCCTGG - Intergenic
1202256810 Y:22929684-22929706 ACTACTTTTTCTGGGAAGCCTGG + Intergenic
1202403271 Y:24497994-24498016 GCTACTTTTTCTGGGAATCCTGG - Intergenic
1202409802 Y:24563437-24563459 ACTACTTTTTCTGGGAAGCCTGG + Intergenic
1202460981 Y:25106640-25106662 ACTACTTTTTCTGGGAAGCCTGG - Intergenic
1202467508 Y:25172087-25172109 GCTACTTTTTCTGGGAATCCTGG + Intergenic