ID: 940446538

View in Genome Browser
Species Human (GRCh38)
Location 2:153784640-153784662
Sequence AGAGTTGCAGCCTCTTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940446538_940446543 28 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446543 2:153784691-153784713 ATACCCCTAGGGTTGAATCCAGG No data
940446538_940446542 17 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446542 2:153784680-153784702 AACTCACATACATACCCCTAGGG No data
940446538_940446541 16 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446541 2:153784679-153784701 AAACTCACATACATACCCCTAGG No data
940446538_940446545 30 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446545 2:153784693-153784715 ACCCCTAGGGTTGAATCCAGGGG No data
940446538_940446544 29 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446544 2:153784692-153784714 TACCCCTAGGGTTGAATCCAGGG No data
940446538_940446540 -9 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940446538 Original CRISPR AGAGTTGCAGCCTCTTTTGC TGG (reversed) Intergenic
No off target data available for this crispr