ID: 940446540

View in Genome Browser
Species Human (GRCh38)
Location 2:153784654-153784676
Sequence TGCAACTCTGGCAAAGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940446537_940446540 -8 Left 940446537 2:153784639-153784661 CCCAGCAAAAGAGGCTGCAACTC 0: 2
1: 6
2: 24
3: 76
4: 215
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data
940446529_940446540 19 Left 940446529 2:153784612-153784634 CCCCAGGAGCTTTAAATACCCGG No data
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data
940446528_940446540 25 Left 940446528 2:153784606-153784628 CCAGAGCCCCAGGAGCTTTAAAT No data
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data
940446531_940446540 18 Left 940446531 2:153784613-153784635 CCCAGGAGCTTTAAATACCCGGG No data
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data
940446533_940446540 17 Left 940446533 2:153784614-153784636 CCAGGAGCTTTAAATACCCGGGC No data
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data
940446527_940446540 26 Left 940446527 2:153784605-153784627 CCCAGAGCCCCAGGAGCTTTAAA No data
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data
940446538_940446540 -9 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data
940446536_940446540 0 Left 940446536 2:153784631-153784653 CCGGGCTTCCCAGCAAAAGAGGC 0: 2
1: 3
2: 11
3: 40
4: 226
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data
940446534_940446540 1 Left 940446534 2:153784630-153784652 CCCGGGCTTCCCAGCAAAAGAGG No data
Right 940446540 2:153784654-153784676 TGCAACTCTGGCAAAGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940446540 Original CRISPR TGCAACTCTGGCAAAGTAGA AGG Intergenic
No off target data available for this crispr