ID: 940446541

View in Genome Browser
Species Human (GRCh38)
Location 2:153784679-153784701
Sequence AAACTCACATACATACCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940446536_940446541 25 Left 940446536 2:153784631-153784653 CCGGGCTTCCCAGCAAAAGAGGC 0: 2
1: 3
2: 11
3: 40
4: 226
Right 940446541 2:153784679-153784701 AAACTCACATACATACCCCTAGG No data
940446538_940446541 16 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446541 2:153784679-153784701 AAACTCACATACATACCCCTAGG No data
940446537_940446541 17 Left 940446537 2:153784639-153784661 CCCAGCAAAAGAGGCTGCAACTC 0: 2
1: 6
2: 24
3: 76
4: 215
Right 940446541 2:153784679-153784701 AAACTCACATACATACCCCTAGG No data
940446534_940446541 26 Left 940446534 2:153784630-153784652 CCCGGGCTTCCCAGCAAAAGAGG No data
Right 940446541 2:153784679-153784701 AAACTCACATACATACCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940446541 Original CRISPR AAACTCACATACATACCCCT AGG Intergenic
No off target data available for this crispr