ID: 940446544

View in Genome Browser
Species Human (GRCh38)
Location 2:153784692-153784714
Sequence TACCCCTAGGGTTGAATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940446537_940446544 30 Left 940446537 2:153784639-153784661 CCCAGCAAAAGAGGCTGCAACTC 0: 2
1: 6
2: 24
3: 76
4: 215
Right 940446544 2:153784692-153784714 TACCCCTAGGGTTGAATCCAGGG No data
940446538_940446544 29 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446544 2:153784692-153784714 TACCCCTAGGGTTGAATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940446544 Original CRISPR TACCCCTAGGGTTGAATCCA GGG Intergenic
No off target data available for this crispr