ID: 940446545

View in Genome Browser
Species Human (GRCh38)
Location 2:153784693-153784715
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940446538_940446545 30 Left 940446538 2:153784640-153784662 CCAGCAAAAGAGGCTGCAACTCT No data
Right 940446545 2:153784693-153784715 ACCCCTAGGGTTGAATCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr