ID: 940446613

View in Genome Browser
Species Human (GRCh38)
Location 2:153785110-153785132
Sequence GAAACAGCAAAGATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940446613_940446619 29 Left 940446613 2:153785110-153785132 CCAAGCTCCATCTTTGCTGTTTC No data
Right 940446619 2:153785162-153785184 TTGGAGAGTCCGAAGCAACTAGG No data
940446613_940446620 30 Left 940446613 2:153785110-153785132 CCAAGCTCCATCTTTGCTGTTTC No data
Right 940446620 2:153785163-153785185 TGGAGAGTCCGAAGCAACTAGGG No data
940446613_940446617 4 Left 940446613 2:153785110-153785132 CCAAGCTCCATCTTTGCTGTTTC No data
Right 940446617 2:153785137-153785159 CCTTAGGTGCTGTTGCTTTCAGG No data
940446613_940446618 10 Left 940446613 2:153785110-153785132 CCAAGCTCCATCTTTGCTGTTTC No data
Right 940446618 2:153785143-153785165 GTGCTGTTGCTTTCAGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940446613 Original CRISPR GAAACAGCAAAGATGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr