ID: 940449446

View in Genome Browser
Species Human (GRCh38)
Location 2:153818843-153818865
Sequence CCAGTCTGTAATATTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940449441_940449446 -1 Left 940449441 2:153818821-153818843 CCTTCTGAAAACTCAAGCCCCAC No data
Right 940449446 2:153818843-153818865 CCAGTCTGTAATATTCCCTCAGG No data
940449440_940449446 0 Left 940449440 2:153818820-153818842 CCCTTCTGAAAACTCAAGCCCCA No data
Right 940449446 2:153818843-153818865 CCAGTCTGTAATATTCCCTCAGG No data
940449436_940449446 30 Left 940449436 2:153818790-153818812 CCATCTGAGCATTTTACCTGCAT No data
Right 940449446 2:153818843-153818865 CCAGTCTGTAATATTCCCTCAGG No data
940449437_940449446 14 Left 940449437 2:153818806-153818828 CCTGCATCCCAGAGCCCTTCTGA No data
Right 940449446 2:153818843-153818865 CCAGTCTGTAATATTCCCTCAGG No data
940449439_940449446 6 Left 940449439 2:153818814-153818836 CCAGAGCCCTTCTGAAAACTCAA No data
Right 940449446 2:153818843-153818865 CCAGTCTGTAATATTCCCTCAGG No data
940449438_940449446 7 Left 940449438 2:153818813-153818835 CCCAGAGCCCTTCTGAAAACTCA No data
Right 940449446 2:153818843-153818865 CCAGTCTGTAATATTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940449446 Original CRISPR CCAGTCTGTAATATTCCCTC AGG Intergenic
No off target data available for this crispr