ID: 940451836

View in Genome Browser
Species Human (GRCh38)
Location 2:153847910-153847932
Sequence TTAGTTCTAGAGCGCTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940451836_940451840 21 Left 940451836 2:153847910-153847932 CCCATGGAGCGCTCTAGAACTAA No data
Right 940451840 2:153847954-153847976 CCATCTTGAGGCAAGAGAGCTGG No data
940451836_940451838 9 Left 940451836 2:153847910-153847932 CCCATGGAGCGCTCTAGAACTAA No data
Right 940451838 2:153847942-153847964 TCAATTTGAGTTCCATCTTGAGG No data
940451836_940451841 28 Left 940451836 2:153847910-153847932 CCCATGGAGCGCTCTAGAACTAA No data
Right 940451841 2:153847961-153847983 GAGGCAAGAGAGCTGGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940451836 Original CRISPR TTAGTTCTAGAGCGCTCCAT GGG (reversed) Intergenic
No off target data available for this crispr