ID: 940453719

View in Genome Browser
Species Human (GRCh38)
Location 2:153871826-153871848
Sequence CAGGCTGGGGCTACGAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940453711_940453719 -7 Left 940453711 2:153871810-153871832 CCCAGTGAGAGGCCTCCAGGCTG 0: 1
1: 0
2: 3
3: 16
4: 232
Right 940453719 2:153871826-153871848 CAGGCTGGGGCTACGAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 293
940453712_940453719 -8 Left 940453712 2:153871811-153871833 CCAGTGAGAGGCCTCCAGGCTGG 0: 1
1: 1
2: 0
3: 44
4: 258
Right 940453719 2:153871826-153871848 CAGGCTGGGGCTACGAGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940453719 Original CRISPR CAGGCTGGGGCTACGAGAGG AGG Intergenic
900185404 1:1331003-1331025 CAGGCTGTGGAGAGGAGAGGGGG - Intergenic
900614048 1:3556427-3556449 CTGGCTGTGGCTCCGTGAGGAGG - Intronic
900685228 1:3944047-3944069 CAGGCTGGGGACAGGAGTGGCGG - Intergenic
900991471 1:6100208-6100230 GAGGCTGGGGCGAGGGGAGGAGG + Exonic
901229665 1:7634679-7634701 CAGGCTGGGGCTGCCGGAGGAGG + Intronic
901829996 1:11886487-11886509 CAGGCCGGGGCCCTGAGAGGAGG + Intergenic
902529133 1:17079230-17079252 CAGGCTGGGGCTAGGGGCTGTGG - Intronic
903297161 1:22350980-22351002 CAGGCAGGGGCCAGGAGAGAGGG - Intergenic
903335970 1:22624892-22624914 CAGGCTGGGGGTTCGAGACATGG + Intergenic
903883977 1:26530558-26530580 CAGGCTGTGGAGACGAGAGTGGG + Intronic
904042087 1:27591015-27591037 CAGGCTGGGGCTGGGAGGTGGGG - Intronic
904494771 1:30880380-30880402 TGGGCTGGGGGTACGAGAGAAGG + Intronic
904590735 1:31614118-31614140 CAGGCAGCCGCTAGGAGAGGAGG - Intergenic
904771112 1:32881964-32881986 AAGGCTGGGGCTGCTTGAGGTGG - Intergenic
906086046 1:43135578-43135600 CAGCCTTGGGCTGGGAGAGGAGG + Intergenic
906140499 1:43531262-43531284 CAGGCTGGGGCGTGGAGGGGGGG - Intronic
906746050 1:48222912-48222934 GAGGCTGGGGCTAGCAGGGGAGG + Intronic
907248689 1:53123628-53123650 CGGGCTGGGCCTCCCAGAGGAGG + Intronic
907488683 1:54794993-54795015 CAGGCTGGGGCCAGGTGGGGCGG - Intronic
908246859 1:62234166-62234188 GAGGCTGGGGCTACGCCAGCGGG - Intergenic
909601500 1:77466116-77466138 GAGGCTGGGGCTCAGAGAGCTGG - Intronic
910292643 1:85614347-85614369 CAGGCTGGGGCAAGGAGGGAAGG + Intergenic
911083614 1:93957815-93957837 CAGGCTGGGGCCATGAGTGCAGG - Intergenic
912956439 1:114156896-114156918 GAGGCTGGGGCAAAGGGAGGAGG + Intergenic
915359626 1:155278071-155278093 CAGGCTGGGGGCACCAGAAGGGG + Intronic
915512094 1:156392028-156392050 CAGCCTCGGGCTACCAGAGCAGG + Intergenic
915958990 1:160248446-160248468 CAGGCTGGGGCTGGGCGTGGAGG + Intronic
916191662 1:162185068-162185090 CAGGATGGGGCCACGAGCTGGGG - Intronic
916874191 1:168951198-168951220 CAAGCTGGGGCTATGGGAGCTGG + Intergenic
917121235 1:171646257-171646279 CATACTGGGGCTCAGAGAGGTGG - Intronic
919766218 1:201129011-201129033 GAGGCTGAGGCTCAGAGAGGAGG + Intergenic
920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG + Intronic
922335575 1:224616265-224616287 GAGGGTGGGGCGCCGAGAGGAGG + Intronic
922794390 1:228332936-228332958 CAGGTAGGGGCTGCCAGAGGTGG + Exonic
924597276 1:245458231-245458253 CAGCCTGGGGTTAAGAGAGAGGG - Intronic
1067557655 10:47284000-47284022 CAGCCTGGGGATGCCAGAGGTGG - Intergenic
1067578267 10:47421160-47421182 CAGGCTGGGACTGTGGGAGGAGG + Intergenic
1067801034 10:49359948-49359970 CTGGATGGGGCAGCGAGAGGGGG - Intergenic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1070811219 10:79299031-79299053 TTGGCTGGGGCGAGGAGAGGAGG - Exonic
1072797568 10:98367647-98367669 CAGACTGAGGCTCAGAGAGGAGG - Intergenic
1074356531 10:112790604-112790626 CAGGGTGGGGCTGCCAGAAGAGG - Intronic
1074538942 10:114349088-114349110 CAGGCTGGGGCTAGGTGCAGTGG + Intronic
1075259875 10:120953958-120953980 GTGGCTGGGGCTGGGAGAGGGGG + Intergenic
1076447297 10:130525348-130525370 AAGGCTCGGGCTCCGGGAGGAGG + Intergenic
1078051668 11:7970462-7970484 CAGGCTGGGAGAAGGAGAGGAGG - Intronic
1078730732 11:13971686-13971708 GGGGCTGGGGCTAGGAGAGGTGG - Intronic
1079224377 11:18592602-18592624 CACTCTGGGGCTAAGACAGGAGG + Intergenic
1079573262 11:21970785-21970807 CAGGCTGAGACTAAGAGGGGTGG + Intergenic
1080465005 11:32488270-32488292 CAGGCTGGGGCCAGGAAAGGTGG - Intergenic
1082202933 11:49395724-49395746 CAGGCAGGGGCTAAAACAGGAGG + Intergenic
1083088907 11:60179785-60179807 CAGGATGGGGCAAAGAGGGGAGG - Intronic
1084008737 11:66336262-66336284 CAGGGAGGGGCTGCGAGAGGAGG - Intronic
1084796174 11:71505936-71505958 CAGGCGGGGCCTGCCAGAGGAGG + Intronic
1085098389 11:73779530-73779552 CCCTCTGGGGCTGCGAGAGGAGG - Intergenic
1086652096 11:89304355-89304377 CAGGCAGGGGCTAAAACAGGAGG - Intergenic
1089005537 11:115087728-115087750 CAGGCTGGGGCTTCTCGGGGAGG + Intergenic
1089704976 11:120271506-120271528 GGGGCTGGGGCCAGGAGAGGTGG - Intronic
1089787945 11:120921536-120921558 CAGGTTGGGGCTGCAGGAGGTGG + Intronic
1091168723 11:133502287-133502309 CAGGGTGGGGGCAGGAGAGGGGG - Intronic
1091197944 11:133747619-133747641 CAGGATGGGGCGAAGACAGGAGG + Intergenic
1091764182 12:3107481-3107503 CAGGCTGGGGTGAGGAGAGAGGG + Intronic
1091978955 12:4850282-4850304 CAGGCTGAGGGTCCGAGAGGGGG + Intronic
1092246751 12:6868082-6868104 GAGTCTGGGGCTACGTGCGGCGG - Intronic
1093843351 12:23933875-23933897 CAGGCTGTTGCTAAGAGATGAGG - Intronic
1094502710 12:31035452-31035474 CAGCCTGCGGCTTCAAGAGGTGG - Intergenic
1094564965 12:31590965-31590987 CAGGCTGCGGCGGCGAGAGGCGG - Exonic
1096580673 12:52582777-52582799 CAGGCAGGGCTTAGGAGAGGGGG + Intergenic
1096784699 12:54010257-54010279 CAGGCTGGTTCTCTGAGAGGAGG - Intronic
1096814850 12:54195678-54195700 GTGGCAGGGGCTAGGAGAGGAGG - Intergenic
1096843199 12:54391302-54391324 CGGGCTGGGGGTACGGGGGGAGG + Intergenic
1096846066 12:54407796-54407818 CAGGCTGGGGCCAAGGGAGGGGG - Intronic
1096865409 12:54559872-54559894 CAGGATGGGGCTGAGAGTGGGGG - Intronic
1098893114 12:76030342-76030364 CAAGCTGGGGCCAGGAGAGCTGG - Intronic
1100359225 12:93860946-93860968 CAGCCTGGCGCTCCGAGGGGAGG - Intronic
1102466380 12:113133107-113133129 CAGGCTGGGTCTGCAGGAGGGGG - Intronic
1102502857 12:113364566-113364588 GAGGCTGGGGCTAAGATGGGAGG - Intronic
1102979790 12:117232213-117232235 GAGGATGGGGCCAGGAGAGGAGG + Intronic
1103325411 12:120116880-120116902 CAGGCTGCGGCTGCGCAAGGCGG - Intronic
1103419225 12:120766740-120766762 CAAGCTGAGGCTCAGAGAGGTGG - Intronic
1104691488 12:130829613-130829635 CAGGCTGTGGGCCCGAGAGGCGG - Intronic
1105295487 13:19085412-19085434 CAGGCTGGGGGATCCAGAGGTGG + Intergenic
1105852734 13:24350027-24350049 CAGGCTCAGGCTAGGAGAGAGGG + Intergenic
1106125897 13:26899784-26899806 CTGGCTGAGGCCAGGAGAGGAGG - Intergenic
1106218787 13:27727158-27727180 CAAACTGGGGCTACGAAGGGAGG + Intergenic
1108603208 13:52012108-52012130 CAGGCGGGGGCTTCTAGTGGGGG + Intergenic
1108945393 13:56016975-56016997 CAGGGTGAGGCTGAGAGAGGAGG - Intergenic
1110183467 13:72645006-72645028 CTGGCTGTGGCAGCGAGAGGAGG - Intergenic
1112141747 13:96651448-96651470 CAAGCTGGGGATATCAGAGGAGG - Intronic
1112277158 13:98032118-98032140 CAGGCTGGGGCCAGGCGCGGTGG - Intergenic
1114628863 14:24146898-24146920 CAGGGTTGGGGTAAGAGAGGTGG + Exonic
1115414384 14:33114176-33114198 CAGGCTGGTGCTACCAAATGTGG + Intronic
1115906669 14:38209421-38209443 CGGGCTGGGGCTAGGAGAGGAGG - Exonic
1118149957 14:63178884-63178906 CAGGTTGGAGGTACGAGATGGGG + Intergenic
1118322860 14:64763503-64763525 CAGGGAGGGGCTGGGAGAGGTGG - Intronic
1119732031 14:76957127-76957149 GAGGCTGGGGCTGAGGGAGGGGG - Intergenic
1119900073 14:78251913-78251935 CAGGCTGTGGCTGGCAGAGGAGG + Intronic
1120651686 14:87141215-87141237 CAGGGTTGGGCCACAAGAGGTGG + Intergenic
1121086567 14:91150968-91150990 CAGGCTGGGTCCAGGAGATGGGG - Intronic
1121288806 14:92757819-92757841 CTGCCTGGGGCTTCGAGAGGTGG - Intergenic
1123219840 14:106844948-106844970 GAGGCTGCGGCGGCGAGAGGGGG - Intergenic
1124158888 15:27251873-27251895 CAGGCCCGGGCTATCAGAGGCGG - Intronic
1125530817 15:40412335-40412357 AAGGCTGGGGCCACGAGTGGGGG + Intronic
1126692064 15:51295380-51295402 CAGGCTGGGCCTAGGAATGGAGG - Intronic
1126837200 15:52679244-52679266 CCGGCCGGGGCTACGGGCGGGGG - Intronic
1127763721 15:62164990-62165012 GAGGCTGGGGCTAGGAGTGGCGG + Exonic
1127956016 15:63854198-63854220 GACACTGGGGCTACTAGAGGGGG + Intergenic
1127971394 15:63965333-63965355 CTGCCTGGGGCTAGGGGAGGGGG + Intronic
1129039470 15:72673692-72673714 CTGGCTGGGGCAGCAAGAGGTGG + Intergenic
1129656834 15:77530027-77530049 CAGGGTGAGGGTAGGAGAGGTGG + Intergenic
1129700173 15:77763300-77763322 CAGCCTGGGGCCTGGAGAGGAGG + Intronic
1130305558 15:82710237-82710259 CAGGCTGGGGGTTCTAGAGCGGG + Intergenic
1132495424 16:260989-261011 GAGGCAGGGGCTTCGAGAGGTGG + Intronic
1132618627 16:854247-854269 CAGGCTGGGCCTCTGGGAGGAGG + Exonic
1132852828 16:2032622-2032644 CTGGCTGGGGATAGGGGAGGTGG + Intronic
1133615169 16:7469347-7469369 CAGGCTGGGGCCAGGTGCGGTGG - Intronic
1133910497 16:10061608-10061630 CAGTCTGGGGCAGAGAGAGGTGG + Intronic
1134523158 16:14927723-14927745 GAGGCAGGGGCTAGGGGAGGGGG - Intronic
1134710825 16:16326374-16326396 GAGGCAGGGGCTAGGGGAGGGGG - Intergenic
1134747472 16:16599359-16599381 CAGGCTGGGGAAATGAGTGGGGG + Intergenic
1134948776 16:18342271-18342293 GAGGCAGGGGCTAGGGGAGGGGG + Intergenic
1134955759 16:18381496-18381518 GAGGCAGGGGCTAGGTGAGGGGG + Intergenic
1134997996 16:18754298-18754320 CAGGCTGGGGAAATGAGTGGGGG - Intergenic
1135031273 16:19040685-19040707 CAGGCTGGGACCCTGAGAGGAGG + Intronic
1137876051 16:51997670-51997692 CAGGCTGGGGCTAGATGAAGAGG + Intergenic
1138588778 16:57987958-57987980 CAGGCTGGGGCAAGGGGAGCTGG + Intronic
1138609514 16:58111493-58111515 GAGGCAGGGGCTACAGGAGGTGG - Intergenic
1139823092 16:69736151-69736173 CAGGCTGGGGCTGGGCGTGGTGG - Intergenic
1141170051 16:81685265-81685287 CAGGCTGGGAGACCGAGAGGAGG + Intronic
1141353440 16:83320826-83320848 CTGGCTTAGGCTACGAGAGTTGG + Intronic
1141611523 16:85183762-85183784 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1142313635 16:89329173-89329195 CAGGCGGGGACTCCGTGAGGAGG + Intronic
1142743052 17:1941806-1941828 CTGGCAGGGGGTACCAGAGGCGG - Intronic
1143032563 17:3976118-3976140 CAGGCTTGGGCTAGGACAGCTGG - Intergenic
1143352008 17:6295698-6295720 CAGGCTGGGGCTGAGGGAAGAGG - Intergenic
1143646685 17:8234860-8234882 CAGGCTGGGGCTCCCAGGAGAGG + Exonic
1143943540 17:10568605-10568627 CTGGCTGGGCCTATGAGTGGAGG + Intergenic
1146776771 17:35626012-35626034 GTGGCAGGGGCTAGGAGAGGGGG + Intronic
1147176153 17:38657454-38657476 CTGGCTGGGGCTCCGGGAGGTGG - Intergenic
1147606654 17:41777472-41777494 CAGGCTGGGGCTGCCCAAGGAGG + Intronic
1147653885 17:42077704-42077726 CAGACTGGGGCTAGGACGGGTGG + Intergenic
1147960733 17:44166114-44166136 CAGGCTGAGGCTAAGGCAGGAGG - Intergenic
1148124709 17:45230747-45230769 CAGGCTGGGGCTATGGGGAGAGG + Intronic
1148241999 17:46005733-46005755 CAGGCTGGAGCTGCGGAAGGAGG - Intronic
1148348809 17:46923409-46923431 CAGGCTGGGGCCTGGAGACGTGG + Intronic
1148725114 17:49783535-49783557 CAGGGTGGGGCTGCGGGTGGGGG + Intronic
1150439531 17:65179887-65179909 CAGGCTGGGTGTACGACAGAGGG + Intronic
1151662185 17:75525090-75525112 GAGGTTGGAGCGACGAGAGGCGG - Intronic
1152419432 17:80184207-80184229 CAGGCTGCGGCAGCGTGAGGCGG - Exonic
1152693844 17:81734162-81734184 CAGGCTGGGGTTGGGTGAGGAGG - Intergenic
1152728581 17:81959391-81959413 CTGGCTGGGGCTCCAGGAGGCGG + Intronic
1153717186 18:7861841-7861863 CAGGGTGGGGGTAAGAGAGTAGG - Intronic
1154123460 18:11670087-11670109 CAGGCTGGGGCTGGGGGAGAGGG - Intergenic
1156314428 18:35953910-35953932 AAGGCTGGGGGGAGGAGAGGAGG + Intergenic
1157784480 18:50469579-50469601 CTGGCTGAGGCCATGAGAGGAGG + Intergenic
1160023983 18:75204256-75204278 CAGCCTGGGGCGGGGAGAGGGGG - Intronic
1160858296 19:1227174-1227196 GGGGCTGGGGCTGGGAGAGGAGG - Intronic
1161435181 19:4258752-4258774 CAGGCTGGTGCTAGGGGATGAGG - Intronic
1161563274 19:4985558-4985580 CAGGCTGGGGCTGCCATGGGAGG + Intronic
1161828544 19:6586176-6586198 CAGGCTGATGCTACGGGAGGCGG + Exonic
1161975129 19:7604363-7604385 AAGGCTGGGGCTTAGAGAGATGG - Intronic
1162909572 19:13841966-13841988 CAGTCTGGGGCTAAGACAGAGGG + Intergenic
1162944025 19:14031672-14031694 CCGGCTGGGGCTGCTTGAGGGGG - Intergenic
1163537909 19:17888281-17888303 CAGGCAGGGGATAAAAGAGGAGG + Intronic
1165108809 19:33489320-33489342 ATGGCTGGGACTAAGAGAGGGGG + Intronic
1167369208 19:49070908-49070930 CAGGCTGGGGCTAGGACACGGGG + Intronic
1167648285 19:50717366-50717388 CAGGCTGGGGCCAGGAGGGCAGG - Intronic
1167694522 19:51006969-51006991 CAGCCTGGGACTAGGAGCGGGGG - Intronic
1168686864 19:58354144-58354166 CAGGCTGTGGTGAGGAGAGGGGG - Intergenic
925793621 2:7519275-7519297 CAGGCTAGGCCTAAGAGATGAGG + Intergenic
927520850 2:23697149-23697171 CAGGCTGGGACTCCCAGCGGAGG - Intronic
932334606 2:70922820-70922842 CAGGCTTGTGCTCAGAGAGGAGG + Intronic
933759769 2:85665468-85665490 CAGGCAGGGCCTAAGGGAGGAGG - Intronic
935814105 2:106830331-106830353 CAGGCTGGGGCTAGAGGATGGGG + Intronic
937861921 2:126718174-126718196 CAGGCTGGGGACAGGAGAGCAGG - Intergenic
939561966 2:143742961-143742983 CAGGCTGGGGTTAAGTGAGCTGG + Intronic
940453719 2:153871826-153871848 CAGGCTGGGGCTACGAGAGGAGG + Intergenic
943208276 2:184928459-184928481 CAGCCTGGGGTTAGGGGAGGGGG + Intronic
943783146 2:191846812-191846834 CAGGCTGGGGCTTGGTGTGGAGG + Exonic
946157739 2:217818120-217818142 CAGGCTGGGGCTTCCAGGGCTGG + Exonic
946157787 2:217818282-217818304 CAGGCTGGGGCTCCCCGGGGTGG + Exonic
948253398 2:236549257-236549279 CAGGCTGGGGCTGGCAAAGGTGG - Intergenic
1170545368 20:17431596-17431618 CAAGCTGGGGCTAAGGGAGTGGG - Intronic
1170612412 20:17925484-17925506 CAGGCTGAGGCTACATGATGGGG + Intergenic
1172116222 20:32574974-32574996 GTGGCTGGGGCTAGGTGAGGTGG - Intronic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1174304884 20:49608137-49608159 CAAGCTGAGGCTCGGAGAGGTGG - Intergenic
1174388330 20:50200473-50200495 CAGGCTAGGGCTACAAAATGCGG - Intergenic
1176110242 20:63407659-63407681 CAGGCTGGTCCTAGGAGATGGGG + Intronic
1176278206 20:64286456-64286478 CAGGCTGGCGCGACGTGCGGGGG - Intronic
1176286440 21:5021573-5021595 GAGGCGGGGGCTCCGGGAGGAGG + Intergenic
1179622737 21:42628147-42628169 CAGGCTGGGGCTGAGACAGGTGG + Intergenic
1179870741 21:44241902-44241924 GAGGCGGGGGCTCCGGGAGGAGG - Intergenic
1179984506 21:44913207-44913229 CTGGCTGGGGCTGCCAGGGGAGG - Intronic
1180200489 21:46221001-46221023 CAGGCCGGGGCTTGGATAGGTGG + Intronic
1180200519 21:46221120-46221142 CAGCCCGGGGCTTGGAGAGGTGG + Intronic
1180646405 22:17342637-17342659 CAGGCAGGGGCCAGGAGGGGCGG + Intergenic
1181048860 22:20229297-20229319 CAAGCTGGGCCGAGGAGAGGAGG - Intergenic
1181583835 22:23842276-23842298 CAGGCTGGGGCTAACAGGAGGGG + Intergenic
1182063765 22:27416488-27416510 CAGGCCGGGGGTGCCAGAGGGGG - Intergenic
1183521765 22:38299793-38299815 CACGCTGGGGCTAGGCGCGGTGG - Intronic
1184486014 22:44779999-44780021 CAGGCTGGGACCCCAAGAGGTGG + Intronic
1185003625 22:48262426-48262448 CAGCATGGGGCTGGGAGAGGTGG + Intergenic
1185253223 22:49816609-49816631 AAGGCTGGGGCTGGGCGAGGTGG + Intronic
949287282 3:2421537-2421559 AAGGCTGGGGCTGGGAGCGGTGG - Intronic
950080633 3:10219691-10219713 CACGCTGGGGCCAGGGGAGGGGG - Exonic
950588605 3:13917473-13917495 GACACTGGGGCTACTAGAGGAGG - Intergenic
952447045 3:33391501-33391523 CAGTCTGGGGCTCAGAGAAGAGG - Intronic
952506105 3:34008042-34008064 CAGGCTGGTGCTTCCCGAGGAGG - Intergenic
953004900 3:38969163-38969185 CAGACTGAGGCTAGGATAGGTGG + Intergenic
953149395 3:40310165-40310187 GCGGCCGGGGCTCCGAGAGGAGG - Intronic
954693723 3:52409744-52409766 CTGGGTGGGGCGACAAGAGGAGG + Intronic
954938173 3:54346022-54346044 GAGGCTGGGGGTAAGGGAGGAGG + Intronic
955265948 3:57444878-57444900 CAGGCCGGGGCTGGGAGGGGAGG - Intronic
959345212 3:105185876-105185898 GATGCTGGGGATACTAGAGGTGG - Intergenic
959444536 3:106422306-106422328 CTGCCAGGGGCTGCGAGAGGGGG + Intergenic
961028829 3:123584848-123584870 GAGGCTGGGGCTCGGGGAGGCGG - Intronic
961386176 3:126524538-126524560 CTGGCTGGGGCTAGGGGTGGCGG + Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
967105927 3:186255039-186255061 CAGGCTGGGGCAACTAGGGAGGG - Intronic
967452637 3:189644244-189644266 CAAGCTGGGGGTATGAGAGAGGG - Intronic
967452647 3:189644281-189644303 CAAGCTGGGGGTATGAGAGAGGG - Intronic
967888509 3:194348367-194348389 CAGACTGGGACTCTGAGAGGTGG - Intronic
968067189 3:195765151-195765173 CAGGCTGGGGCTGCCAGGGGCGG + Intronic
969097661 4:4745808-4745830 CAGAATGGGGCTAGGAGAGCTGG + Intergenic
969725449 4:8915655-8915677 CAGCCTGGGGCTGGCAGAGGAGG + Intergenic
972209155 4:36815762-36815784 CAGGATGGGTCTCTGAGAGGAGG - Intergenic
976959913 4:90957385-90957407 CAGGCTGGGGCTAGGCACGGTGG - Intronic
982121816 4:152150371-152150393 GAGGCTGGGGTTGGGAGAGGTGG - Intergenic
984203186 4:176753069-176753091 CAGGCTAGAGGTAGGAGAGGCGG - Intronic
984852081 4:184163033-184163055 CAGGCTGGAGAAACCAGAGGAGG + Intronic
985703498 5:1387408-1387430 CAGGCTGGGGTGAGGGGAGGAGG + Intergenic
985778372 5:1857085-1857107 CAGGCTGGGGCGGCGTGGGGCGG + Intergenic
985996986 5:3602595-3602617 CAGGCTGGGGGTGCGAGCGGAGG - Intergenic
986836336 5:11642584-11642606 GAGGGTGGGGCTGCGAGATGAGG + Intronic
987051429 5:14149557-14149579 CAGAGTGAGGCTACGAGCGGGGG + Intronic
987586305 5:19861380-19861402 TAGGCTGGGTATACCAGAGGGGG + Intronic
988337631 5:29927093-29927115 CAGGCTGGGGCTGGGTGTGGTGG + Intergenic
991366603 5:65874992-65875014 AAGGCTGGGGCTAGGTGTGGTGG + Intergenic
992326624 5:75666269-75666291 CAGGCTGGGGCTTGGGGAAGAGG - Intronic
993030314 5:82697991-82698013 CAGAATGGGGCAGCGAGAGGTGG + Intergenic
995071231 5:107923975-107923997 CAATGTGGGGCTAGGAGAGGGGG + Intronic
997260975 5:132465345-132465367 CAGGCTGGGGGTAGGAGCTGTGG - Intronic
997423576 5:133787745-133787767 CAGGCTGGGGCTGTGAGTGTAGG - Intergenic
1001017672 5:168156128-168156150 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1001057177 5:168459399-168459421 CAGGCTGGAGCCAGGAGAGCTGG + Intronic
1001407339 5:171485413-171485435 CTGTCTGGGGCTTGGAGAGGGGG - Intergenic
1001954924 5:175842640-175842662 CTGGCTGGGGCCAGGGGAGGAGG - Intronic
1002605716 5:180381625-180381647 CAGGCTGGGGCGATGGGAGCAGG + Intergenic
1003544873 6:7051371-7051393 CCGGCGGGGGCTACGAGGTGTGG - Intergenic
1004740194 6:18452689-18452711 AAGGCAGGGGCTAGGAGAGGAGG - Intronic
1006168778 6:32081322-32081344 CAGGATGGGGCTAGCAGGGGAGG + Intronic
1006513758 6:34534896-34534918 CAGGCAGGAGCTACAGGAGGAGG - Exonic
1006782710 6:36643050-36643072 CTGGCTGGGGCTAGGCCAGGGGG + Intergenic
1006910625 6:37561299-37561321 CTGCCTGGGGCTAGGAGAGAGGG - Intergenic
1007072529 6:39048081-39048103 GAGGCTGGAGCTGCAAGAGGTGG + Intergenic
1007178911 6:39914595-39914617 CAGGCTGGGGGTGCTGGAGGGGG - Intronic
1007576634 6:42929411-42929433 CGGGCTGCGGCTGCGAGAGGAGG + Exonic
1016599608 6:145843031-145843053 CAGGCAGGGGCAGCGGGAGGAGG - Intergenic
1017811387 6:157986263-157986285 CAGCCTCCGGCTAGGAGAGGAGG - Intronic
1018757430 6:166862457-166862479 CGGGCTGGGGCGAGGAAAGGAGG + Exonic
1019473715 7:1234011-1234033 CAGGCAGGGGCGAGGAGGGGAGG + Intronic
1019710309 7:2515424-2515446 CAGGATGGGGGTAGCAGAGGGGG + Intronic
1019738713 7:2662560-2662582 CAGGCTGGGGCTGCGGGCTGAGG + Exonic
1019808297 7:3145272-3145294 CTGGCTGGGGCTACTCCAGGGGG - Intronic
1020005452 7:4781669-4781691 CAGGCTGAGGCTGTCAGAGGGGG - Exonic
1020244942 7:6422716-6422738 GACACTGGGGCTACTAGAGGAGG + Intronic
1023516579 7:41008095-41008117 AAAGCTGGGTCTACGGGAGGGGG - Intergenic
1023875732 7:44285325-44285347 CAGGCTGGGGCTGGGAGAAAGGG + Intronic
1023885325 7:44349817-44349839 CAGGATGCGGCAAGGAGAGGAGG - Intergenic
1023912985 7:44568529-44568551 CAGCCTGGGGCCACCATAGGGGG - Intronic
1024748223 7:52431518-52431540 CAGCCTGGGGCTCCAAGAGCAGG + Intergenic
1026111120 7:67459602-67459624 CAAGCTGGTGATACGGGAGGGGG - Intergenic
1026977449 7:74507137-74507159 CAGGTTGGGGGTACAGGAGGTGG + Intronic
1027198920 7:76050170-76050192 CAGGCAAGGGCTACGACAGCTGG + Intronic
1027228198 7:76258049-76258071 CTGGCTGGGGCTGCGGGAGCAGG + Intronic
1027395248 7:77747079-77747101 CAGAGTGGGGCTATGAGAAGAGG - Intronic
1029508199 7:100975640-100975662 GCTGCTGGAGCTACGAGAGGGGG + Intronic
1030528113 7:110677914-110677936 CAGGATGGTGATACCAGAGGGGG - Intronic
1031777438 7:125920421-125920443 GAGGGGGGGGATACGAGAGGAGG - Intergenic
1032341268 7:131075535-131075557 CAGCCTGGGTCTAGGAGTGGAGG - Intergenic
1033282230 7:140014407-140014429 CAGGCTGGGGCTGAGGTAGGAGG + Intronic
1035125249 7:156604468-156604490 AAGGCTGGGGAGACGAGGGGGGG - Intergenic
1035236280 7:157499577-157499599 GATGCTGGGGCTCGGAGAGGTGG - Intergenic
1035469291 7:159099525-159099547 CAGGCTGGGGCTCAGAAAGGAGG + Intronic
1038288888 8:26230867-26230889 CAGCCTGGGGCAGGGAGAGGGGG - Intergenic
1039917932 8:41873521-41873543 CAGGCTGTGGTTACAAGTGGTGG + Intronic
1041725081 8:61010744-61010766 CAGCCTGGGGCCAGGAGAGCTGG - Intergenic
1048038136 8:130697171-130697193 CAGGCTGAGGCCAAGACAGGTGG - Intergenic
1049194314 8:141307443-141307465 CAGGCTGGGGGTCCGAGGCGGGG + Intronic
1049198501 8:141328482-141328504 CTGGCTTGGGCTCCAAGAGGCGG - Intergenic
1056624046 9:88239105-88239127 CCGGATGGGGCTCCTAGAGGAGG - Intergenic
1058000910 9:99863893-99863915 CAAGCAGGTGCTAGGAGAGGAGG - Exonic
1059669562 9:116479401-116479423 CAGGCTGTGCCCAGGAGAGGTGG + Intronic
1060518855 9:124282609-124282631 CAGGCTGGGGCCACAGGGGGTGG + Intronic
1060907332 9:127318645-127318667 GAGGGTGGGGGCACGAGAGGTGG - Intronic
1060934148 9:127506064-127506086 CAGGCTGGGGCCGGGAGAAGGGG + Exonic
1061395484 9:130341399-130341421 CAGGCTGTGGCTGGGAGAGCTGG - Intronic
1062016365 9:134293217-134293239 CAGGCTGGGGCTCCTGGAGGGGG + Intergenic
1062070665 9:134553502-134553524 CAGGCTGGGGAGAGGAGAGCAGG + Intergenic
1062411675 9:136428985-136429007 TAGGCTTGGCCTATGAGAGGAGG + Exonic
1062524876 9:136974125-136974147 CAGGGTGGTGCTGGGAGAGGTGG + Intergenic
1185566613 X:1099756-1099778 CAGGCTGGGGGAAGAAGAGGAGG + Intergenic
1186415811 X:9382287-9382309 CAGGCTGGGGCTTAGAGCAGAGG - Intergenic
1187495289 X:19790036-19790058 CAGGCTGGGCCTCTTAGAGGAGG - Intronic
1187532142 X:20106754-20106776 CATGCTGAGGCTAGGTGAGGTGG + Intronic
1188514106 X:30966577-30966599 CAGGTTGGGGCATCAAGAGGCGG + Intronic
1189736177 X:44072102-44072124 CAGGGTGGGGCCAGGGGAGGTGG + Intergenic
1189803567 X:44714124-44714146 CAGGCTGGCTCTTGGAGAGGGGG - Intergenic
1189973688 X:46442067-46442089 CAGGCTGGGTCTACATGAAGGGG + Intergenic
1190597013 X:52060904-52060926 GAGGCTGGGGCTGGGTGAGGGGG + Intergenic
1190611811 X:52193169-52193191 GAGGCTGGGGCTGGGTGAGGGGG - Intergenic
1191774769 X:64801916-64801938 CAGACTGGGGCTATGGGAGGGGG - Intergenic
1192062098 X:67838422-67838444 CAGCCTGGGGTTAGGGGAGGAGG - Intergenic
1194949207 X:100105040-100105062 CATCCTGGGTCAACGAGAGGAGG - Intergenic
1196973815 X:121137594-121137616 CATGCTGAGGCAACAAGAGGTGG + Intergenic
1197147414 X:123185112-123185134 CAGGCTGGTGCTGGGGGAGGTGG + Intronic
1199294405 X:146140993-146141015 CTGGCTGGGGCCAAGAGAGTAGG - Intergenic
1200055166 X:153456433-153456455 CAGCCTGGGGCTGGGACAGGAGG + Intronic