ID: 940465050

View in Genome Browser
Species Human (GRCh38)
Location 2:154016737-154016759
Sequence CAAGCCAACAGGATGATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940465048_940465050 0 Left 940465048 2:154016714-154016736 CCTAGATTGTTAAATCAACAAAT No data
Right 940465050 2:154016737-154016759 CAAGCCAACAGGATGATTTGAGG No data
940465046_940465050 13 Left 940465046 2:154016701-154016723 CCACTGCGCCTGGCCTAGATTGT No data
Right 940465050 2:154016737-154016759 CAAGCCAACAGGATGATTTGAGG No data
940465047_940465050 5 Left 940465047 2:154016709-154016731 CCTGGCCTAGATTGTTAAATCAA No data
Right 940465050 2:154016737-154016759 CAAGCCAACAGGATGATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940465050 Original CRISPR CAAGCCAACAGGATGATTTG AGG Intronic
No off target data available for this crispr