ID: 940470280

View in Genome Browser
Species Human (GRCh38)
Location 2:154089201-154089223
Sequence AGGAATTTTGCCCATGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940470280_940470287 14 Left 940470280 2:154089201-154089223 CCTACTCCATGGGCAAAATTCCT No data
Right 940470287 2:154089238-154089260 TGTAGTTGGCTCCTGGACAGTGG No data
940470280_940470283 0 Left 940470280 2:154089201-154089223 CCTACTCCATGGGCAAAATTCCT No data
Right 940470283 2:154089224-154089246 GTGTCTCCCTGCTCTGTAGTTGG No data
940470280_940470286 7 Left 940470280 2:154089201-154089223 CCTACTCCATGGGCAAAATTCCT No data
Right 940470286 2:154089231-154089253 CCTGCTCTGTAGTTGGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940470280 Original CRISPR AGGAATTTTGCCCATGGAGT AGG (reversed) Intronic
No off target data available for this crispr