ID: 940472089 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:154113118-154113140 |
| Sequence | GACAGCTCTAGACCTGTTAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 940472089_940472091 | 11 | Left | 940472089 | 2:154113118-154113140 | CCAGTAACAGGTCTAGAGCTGTC | No data | ||
| Right | 940472091 | 2:154113152-154113174 | GAATAGTTATCTGCAGAAGATGG | 0: 14 1: 194 2: 203 3: 139 4: 330 |
||||
| 940472089_940472092 | 16 | Left | 940472089 | 2:154113118-154113140 | CCAGTAACAGGTCTAGAGCTGTC | No data | ||
| Right | 940472092 | 2:154113157-154113179 | GTTATCTGCAGAAGATGGCATGG | 0: 180 1: 172 2: 120 3: 86 4: 284 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 940472089 | Original CRISPR | GACAGCTCTAGACCTGTTAC TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||