ID: 940472089

View in Genome Browser
Species Human (GRCh38)
Location 2:154113118-154113140
Sequence GACAGCTCTAGACCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940472089_940472091 11 Left 940472089 2:154113118-154113140 CCAGTAACAGGTCTAGAGCTGTC No data
Right 940472091 2:154113152-154113174 GAATAGTTATCTGCAGAAGATGG 0: 14
1: 194
2: 203
3: 139
4: 330
940472089_940472092 16 Left 940472089 2:154113118-154113140 CCAGTAACAGGTCTAGAGCTGTC No data
Right 940472092 2:154113157-154113179 GTTATCTGCAGAAGATGGCATGG 0: 180
1: 172
2: 120
3: 86
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940472089 Original CRISPR GACAGCTCTAGACCTGTTAC TGG (reversed) Intronic
No off target data available for this crispr