ID: 940474099

View in Genome Browser
Species Human (GRCh38)
Location 2:154138342-154138364
Sequence AGAATGTAAGAGGATAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940474096_940474099 1 Left 940474096 2:154138318-154138340 CCAGTTTAATTCTTATATCACCA No data
Right 940474099 2:154138342-154138364 AGAATGTAAGAGGATAAAGAAGG No data
940474095_940474099 20 Left 940474095 2:154138299-154138321 CCTATTAATCTGTATTATGCCAG No data
Right 940474099 2:154138342-154138364 AGAATGTAAGAGGATAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940474099 Original CRISPR AGAATGTAAGAGGATAAAGA AGG Intronic
No off target data available for this crispr