ID: 940476143

View in Genome Browser
Species Human (GRCh38)
Location 2:154165767-154165789
Sequence AGTGAAATTAGACCAAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940476141_940476143 12 Left 940476141 2:154165732-154165754 CCAAAGGGCACTGATTGTAGTTT No data
Right 940476143 2:154165767-154165789 AGTGAAATTAGACCAAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940476143 Original CRISPR AGTGAAATTAGACCAAGATC TGG Intronic
No off target data available for this crispr