ID: 940484156

View in Genome Browser
Species Human (GRCh38)
Location 2:154275859-154275881
Sequence CACAGGAATGGAGCTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940484148_940484156 17 Left 940484148 2:154275819-154275841 CCAGGAAAGCTGACAGGAGAGGG No data
Right 940484156 2:154275859-154275881 CACAGGAATGGAGCTACCCAAGG No data
940484146_940484156 18 Left 940484146 2:154275818-154275840 CCCAGGAAAGCTGACAGGAGAGG No data
Right 940484156 2:154275859-154275881 CACAGGAATGGAGCTACCCAAGG No data
940484145_940484156 22 Left 940484145 2:154275814-154275836 CCAACCCAGGAAAGCTGACAGGA No data
Right 940484156 2:154275859-154275881 CACAGGAATGGAGCTACCCAAGG No data
940484143_940484156 23 Left 940484143 2:154275813-154275835 CCCAACCCAGGAAAGCTGACAGG No data
Right 940484156 2:154275859-154275881 CACAGGAATGGAGCTACCCAAGG No data
940484142_940484156 24 Left 940484142 2:154275812-154275834 CCCCAACCCAGGAAAGCTGACAG No data
Right 940484156 2:154275859-154275881 CACAGGAATGGAGCTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940484156 Original CRISPR CACAGGAATGGAGCTACCCA AGG Intronic
No off target data available for this crispr