ID: 940484580

View in Genome Browser
Species Human (GRCh38)
Location 2:154281365-154281387
Sequence TTGTTGATCTAAAGGACAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940484577_940484580 6 Left 940484577 2:154281336-154281358 CCACAATACAATCAGAACCATGT No data
Right 940484580 2:154281365-154281387 TTGTTGATCTAAAGGACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940484580 Original CRISPR TTGTTGATCTAAAGGACAAT TGG Intronic
No off target data available for this crispr