ID: 940488301

View in Genome Browser
Species Human (GRCh38)
Location 2:154324795-154324817
Sequence CCAAGCAACCACACTCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940488301_940488305 6 Left 940488301 2:154324795-154324817 CCGGCAGGAGTGTGGTTGCTTGG No data
Right 940488305 2:154324824-154324846 CCAGTGAGTCTATTTATAATAGG No data
940488301_940488306 9 Left 940488301 2:154324795-154324817 CCGGCAGGAGTGTGGTTGCTTGG No data
Right 940488306 2:154324827-154324849 GTGAGTCTATTTATAATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940488301 Original CRISPR CCAAGCAACCACACTCCTGC CGG (reversed) Intronic
No off target data available for this crispr