ID: 940488832

View in Genome Browser
Species Human (GRCh38)
Location 2:154330594-154330616
Sequence CTGGATAATCAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940488832_940488837 -8 Left 940488832 2:154330594-154330616 CCCTGCTCCTTCTGATTATCCAG No data
Right 940488837 2:154330609-154330631 TTATCCAGGGACCAGTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940488832 Original CRISPR CTGGATAATCAGAAGGAGCA GGG (reversed) Intronic
No off target data available for this crispr