ID: 940491743

View in Genome Browser
Species Human (GRCh38)
Location 2:154370622-154370644
Sequence AAGGAAGAACATTTTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940491738_940491743 2 Left 940491738 2:154370597-154370619 CCATTTGCTAAAATGGAGAAGAT No data
Right 940491743 2:154370622-154370644 AAGGAAGAACATTTTGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940491743 Original CRISPR AAGGAAGAACATTTTGGGGT TGG Intronic
No off target data available for this crispr