ID: 940491952

View in Genome Browser
Species Human (GRCh38)
Location 2:154373775-154373797
Sequence CCTGTTAAGTGGCTATTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940491952_940491957 1 Left 940491952 2:154373775-154373797 CCTTGTAATAGCCACTTAACAGG No data
Right 940491957 2:154373799-154373821 GTGGCAGGAGTACTGTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940491952 Original CRISPR CCTGTTAAGTGGCTATTACA AGG (reversed) Intronic
No off target data available for this crispr