ID: 940492551

View in Genome Browser
Species Human (GRCh38)
Location 2:154382153-154382175
Sequence CTGTGTCCATAGAGGGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940492551_940492558 -2 Left 940492551 2:154382153-154382175 CCCAATCCCCTCTATGGACACAG No data
Right 940492558 2:154382174-154382196 AGAGGGTTTGTTAAATTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940492551 Original CRISPR CTGTGTCCATAGAGGGGATT GGG (reversed) Intronic
No off target data available for this crispr