ID: 940498901

View in Genome Browser
Species Human (GRCh38)
Location 2:154469797-154469819
Sequence TGTCCAGTCGTTAAAGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940498896_940498901 20 Left 940498896 2:154469754-154469776 CCTGAATTCAGGAAATTTCATAG No data
Right 940498901 2:154469797-154469819 TGTCCAGTCGTTAAAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940498901 Original CRISPR TGTCCAGTCGTTAAAGTCAG TGG Intergenic
No off target data available for this crispr