ID: 940498913

View in Genome Browser
Species Human (GRCh38)
Location 2:154469912-154469934
Sequence GACCTGGGTAAGCACCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940498913_940498920 2 Left 940498913 2:154469912-154469934 CCATCAAGGTGCTTACCCAGGTC No data
Right 940498920 2:154469937-154469959 AGGGGATATAAAAGGTATATTGG No data
940498913_940498921 9 Left 940498913 2:154469912-154469934 CCATCAAGGTGCTTACCCAGGTC No data
Right 940498921 2:154469944-154469966 ATAAAAGGTATATTGGAAAATGG No data
940498913_940498919 -6 Left 940498913 2:154469912-154469934 CCATCAAGGTGCTTACCCAGGTC No data
Right 940498919 2:154469929-154469951 CAGGTCATAGGGGATATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940498913 Original CRISPR GACCTGGGTAAGCACCTTGA TGG (reversed) Intergenic
No off target data available for this crispr