ID: 940498925

View in Genome Browser
Species Human (GRCh38)
Location 2:154470132-154470154
Sequence TTAGATGGTAGAGGTACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
940498925_940498930 27 Left 940498925 2:154470132-154470154 CCTCCCGTACCTCTACCATCTAA No data
Right 940498930 2:154470182-154470204 TCTAAGCATTTGAGAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
940498925 Original CRISPR TTAGATGGTAGAGGTACGGG AGG (reversed) Intergenic
No off target data available for this crispr